Name Label the diagrams as you read the following passage 25

Last updated: 5/15/2023

Name Label the diagrams as you read the following passage 25 Phase Met Pro 5 Translation Part 4 UCA Ser Arg 26 27 AUGCCUAGUCGGUAAAAAAAAA 3 The termination phase begins when the stop codon reaches the A site At this point the completed amino acid sequence is attached to the tRNA in the P site The ribosome senses that the stop codon is in the A site and opens up letting go of the messenger RNA The tRNA releases the amino acid sequence and the protein folds into the shape it needs to be in to perform its function in the cell In this example a very short protein is shown But in reality the average human protein length is around 375 amino acids long After termination the ribosome waits until it bumps into another 5 methyl G cap of another mRNA mole cule and can begin producing a different protein The messenger RNA can also be re used by this ribosome or another ribosome to produce an identical amino acid sequence The tRNAs are recycled as well They will attach to their proper amino acids and carry them to another ribosome wherever their anti codon matches the codon Circle the stop codon Look back at your first 3 Translation pages and highlight the codons and amino acids they correspond to in the diagram above using the colors you used on the previous pages