Question:

Take the following DNA sequence.

Last updated: 7/25/2022

Take the following DNA sequence.

Take the following DNA sequence. tgagggctatcctagcgatgcaggttggag a. Show what the other side of the DNA sequence would look like. b. What would the mRNA strand made from this sequence look like? c. A codon is a 3-nucleotide mRNA sequence that codes for an amino acid. How many CODONS does the mRNA strand from 'b' contain?