Question:

When mRNA is translated, each of the codons below codes for

Last updated: 7/9/2022

When mRNA is translated, each of the codons below codes for

When mRNA is translated, each of the codons below codes for serine. • UCU • UCC • UCG • UCA When translated, which of the following DNA sequences would lead to a serine amino acid in the peptide. ATGGGTCAAATCGTGTACTGA ATGGGTCTAATCGGGTTCTGA ATGCGTCAAAACGTCTACTGA ATGGGTCAAAGCGTGTCCTGA