Question:

You are asked to subclone the T7 RNA polymerase in the PGEX

Last updated: 10/5/2023

You are asked to subclone the T7 RNA polymerase in the PGEX 4T 3 vector Which of the following forward primers should you use to PCR amplify your T7 RNA polymerase On the primer sequence the restriction recognition site is underlined and the starting ATG of the T7 RNA polymerase is shown in bold Restriction sites are shown in brackets in the pGEX4T 3 schematic PGEX 4T 3 Thrombin Leu Val Pro Arg Gly Serl Pro Asn Ser Arg Val Asp Ser Ser Gly Arg Ile Val Thr Asp CTG GTT CCG CGT GGA TCC CCG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA t 4 BamHI EcoRI Sall Smal Xhol Notl Stop codons TAATAGGATCCATGAACACGATTAACATCGCTAAG BamHI TAATAGCGGCCGCTGAATGAACACGATTAACATCGCTAAG Notl TAATAGAATTCATGAACACGATTAACATCGCTAAG EcORI TAATACTCGAGCGATGAACACGATTAACATCGCTAAG Xhol TAATANCOCOCCINTCANCACCATTAACATCOSINAC ISmall