Biological Classification Questions and Answers

ick to see additional instructions magine a population evolving by genetic drift in which the frequency of allele K is 0 2 What is the probability that at some point in the future allele K will drift to a frequency of 17

In the figure below which of the following listed body parts is responsible for the feeding mechanisms in lophophorates Lateral arm of lophophore Spiral portion of lophophore Dorsal brachial valve Mouth dorsal valve ciliated food groove water current direction of food movement Ciliated food groove Direction of food movemer Water current

You are part of a research team studying the kit fox population in the San Joaquin Valley You observe that the abundance of foxes varies depending on the presence of coyotes their main predator Your research team designs an experiment to compare the abundance of kit foxes for areas with and without coyotes n 10 sampling areas per area type Below are the data the team recorded for kit fox abundance for each area Provide your answers below in either blue red or purple to make your responses obvious to your instructor Submit this page to the lab assignment on Canvas Coyote 16 10 15 13 7 14 15 9 12 17 No coyote 20 17 25 27 22 19 26 30 24 25 1 What is the independent variable 0 5 pt 2 What is the dependent variable 0 5 pt 3 What are the null and alternate hypotheses 1 pt 4 Create an appropriately formatted descriptive statistics table as discussed in class Your table should include the mean standard deviation standard error of the mean and the lower and upper 95 confidence intervals for each habitat Do NOT include any other descriptive statistics in your table Your table cannot be handwritten 2 pt 5 Create an appropriately formatted comparison of means figure with caption in Excel as discussed in class Use 3 significant figures for decimal values Make sure to include 95 confidence intervals for error bars for each mean symbol 2 pt 6 Conduct a t test and report the results to determine if the groups of kit foxes are different 3 pt 7 Draw a conclusion based on your results 1 pt

I Does the size of acritarchs support the interpretation of them representing eukaryotes

purple and sulphur bacteria 1 List one of the metabolic reactions that cyanobacteria use cyanobacteria fermenters

6 There are many different resources that may be used However not all resources are reliable So it is important to learn how to discern reliable resources from resources that are not as reliable For example Wikipedia is a great jumping off point but you should never cite information directly from Wikipedia this is a good rule of thumb for websites in general in most scientific writing Rarely are they acceptable and you should get approval from your instructor before citing information from one a Why shouldn t Wikipedia be used as a cited source i e why might it be unreliable Go to the Wikipedia page and read about how it works if you need help with this one

What is one common mistake taxonomists may make when attempting to place seemingly closely related species into a shared classification group The two species seem to be located in the same region on the planet The two species share many structural proteins genes and metabolic pathways The two species share similar morphology or character traits but their is not confirmed homology The two species share an evolutionary history based upon matching segments of DNA

Based on what you know and what you have learned abel the anatomy of the urchin with the letter that fits each organ You may also visit http purpleseaurchinreasource weebly com digestiverespiratory html a gills c Aristotle s Lantern b tubed feet d anus Data collection Visit http www ipacoa org Explorer axial organ gonad intestine stone Canal dy Section AA madreporite test madreporic amputa Click on the Filters on the left side of the page Click on Washington State and Alaska and you will see some platforms buoy disappear Then scroll down to Variables Select Dissolved Oxygen and you will see some platforms buoy disappear As you navigate each platform buoy a box will appear on the right Click on the Oxygen Percent Saturation Oxygen Pct Sat Spend time exploring the data at differ Depth is in parentheses Da P notice any pattes tooth perignathic girdle dorsal sec Jaboral haemal ring Co ambuecral termination polian mouth vesicle rotula GROSOPA perihaemal opulla Canal ASPAUS radial Water canal radial haemal strand

Endosymbiosis describes O One cell destroying another cell O One cell inside another cell providing a benefit O Two cells living close together to the benefit of both O One cell eating another

Questions 8 11 refer to the following situation Ant zombification begins when an Ophiocordyceps fungus shoots spores onto an insect The fungus then takes over the ant s brain and causes it to move to a cool location The fungus then kills the ant when fruiting bodies erupt from the ant s head as in the picture and spread more spores Ants that are heterozygous at the brain power gene are resistant to zombification while both homozygous genotypes are susceptible The table below shows the numbers of ants that survive zombification for each genotype Genotype BB Bb bb ants at birth before zombification 250 400 350 ants after zombification 150 320 70 Q8 What is the absolute fitness of the BB genotype af

Which of the following methods initially identified the circular crater shape at depth in the earth s crust using waves from small explosions to image the subsurface O digging many trenches that exposed layers of sedimentary rock

This event also marks the boundary between the O Paleozoic and Mesozoic Mesozoic and Cenozoic Paleozoic and Cenozoic

The extinction event at the above locality is best seen in the fossil record of which groups of organisms land plants fishes dinosaurs foraminifera mammals

Problem 1 10 P Figure 1 shows a phylogenetic tree of a small outbreak of bacterial pathogen Colors represent patients from which the samples were drawn Patient 1 Patient 4 Patient 2 Patient 5 Patient 3 Figure 1 Phylogenetic tree of the outbreak 1 1 5 P For each patient identify the MRCA of all their isolates Circle and label it on the tree 2 5 P Infer the transmission chain that most parsimoniously explains this phylogeny

Seep Lip in I difference between eukaryotic and prokaryotic cells is that eukaryotic cells prokaryotic cells have DNA which is lacking in have membrane enclosed structures called organelles which are lacking in have a plasma membrane which is lacking in have a nucleoid region which is lacking in

13 Internal skull label bony elements only 15 Lateral skull label bony elements only

7 Mandible lateral view 8 Sphenoid superior view 10 Frontal anterior view 11 Parietal lateral view

14 Inferior skull label bony elements and only foramina canals 16 Anterior skull label bony elements only

me next two questions ask you to think about how antibiotic resistance evolves within a atient infected by a tuberculosis bacterium that is sensitive to antibiotics It is a good dea to read both questions before you begin your answer a Describe the change that occurs in a population of tuberculosis bacteria with regard to antibiotic resistance within an infected patient during the generations BEFORE antibiotic treatment is initiated Make sure you explain both 1 WHAT changes and 2 HOW this change occurs b Describe the change that occurs in a population of tuberculosis bacteria with regard to antibiotic resistance within an infected patient AFTER antibiotic treatment is initiated Make sure you explain both 1 WHAT changes and 2 HOW this change occurs

What effect did the point mutation have on the sequenced polypeptide in this exercise Reference your results recorded in Data Table 2 in your explanation BI Type answer here Question 2 B IU What effect did the frameshift mutation have on the sequenced polypeptide in this exercise Reference your results recorded in Data Table 2 in your explanation T T O Word s

You are conducting an experiment by trying to reproduce the work performed in 1891 by Hans Driesch a German embryologist You are working with a fertilized sea urchin egg and allow it to complete the first cell division after fertilization You then carefully separate the two cells of the embryo and allow their development to continue Based on Driesch s experiment which result below would you expect to happen O Both of the cells will die O Both cells develop into complete and normal embryos that are somewhat smaller O One cell develops into a normal though smaller embryo the other dies O One cell develops into half an embryo the other develops into the other half of the embryo O One cell develops into a defective embryo and the other dies QUESTION 26 Why are viruses not considered to be organisms and not described as being alive O Virions are unable to reproduce by themselves O Virions are not able to metabolize by themselves O Virions are not able to synthesize DNA by themselves O Virions are not able to assemble spontaneously O Virions are unable to reproduce by themselves to metabolize by themselves or to assemble spontaneously

mulight Microscopes were constructed by the end of the sixteenth century What is a compound microscope O It has a moveable stage O It has two lenses O Its lens is double the size of the original microscopes O The lens has two different colors O They have two different light sources QUESTION 31 Which of the following statements about viruses is not true O All viruses are obligatory intracellular parasites O All viruses are obligatory intercellular parasites O Viruses occur in a wide variety of very different shapes sizes and constructions O A viral host may be a plant an animal or a bacterial cell O Viral genetic material can be either RNA or DNA QUESTION 32 Potato spindle tuber disease which causes potatoes to become gnarled and cracked is caused by an infectious agent consisting of a small circular RNA molecule that totally lacks a protein coat These infectious agents are thought to exert their effects by interfering with the cell s normal path of gene expression Such an infectious agent is known as a n

Who is generally credited with the discovery of cells O Leeuwenhoek Hooke Schleiden Schwann O Virchow QUESTION 40 The collection of bacteria that live on and within the human body are being isolated identified and characterized they are referred to as the human QUESTION 41

What is the extinction coefficient in 1 M cm at 280 nm for the unfolded peptide with the following amino acid sequence MKWVYTFISLLW 12660 12615 12785 12490

a With your total magnification set at 40x and the top thread in focus is the bottom thread visible In focus b With your total magnification set at 100x and the top thread in focus is the bottom thread visible In focus C With your total magnification set at 400x and the top thread in focus is the bottom thread visible In focus d What does this tell you about the relationship between magnification and depth of field

Which statement is true regarding the pairing of bases in DNA O Cytosine is always bonded to thymine O Thymine is always bonded to adenine O Adenine is always bonded to cytosine Adenine is always bonded to guanine Which of the following is an example of a heterotroph O algae tiger moss flower

Which characteristic of the garden pea made it a good choice for Mendel s 1 point genetic experiments The garden pea has only one characteristic that varies OGarden peas only reproduce through the process of self pollination The pea plant has seven observable characteristics that are expressed in exactly two ways O The reproduction process for the garden pea occurs slowly Which statement is true regarding a dihybrid cross O A dihybrid cross has no relationship to a monohybrid cross A dihybrid cross involves two genes and up to four alleles A dihybrid cross involves two genes and exactly two alleles A dihybrid cross is exactly the same as a monohybrid cross 1 point

Peer reviewed scientific journal CDC website WHO website Influencer blog Question 6 1 point Listen True or False Non enveloped viruses are lacking a lipid bilayer True

Place the viral infection steps in the correct order Entry Assembly Synthesis Release Attachment

When DNA sequences are used for phylogenetic analyses each nucleotide position can be considered a trait Using the data provided below 57 bases from the mitochondrial DNA sequences of three chameleons and one lizard map ONLY the synapomorphic traits onto the phylogenetic tree provided below Note the horizontal branch on the tree where each trait transition takes place by using a line and the number of the base base numbers can be determined using the 10 50 marks above the sequence As an example of how I want you to map the traits onto the tree I have chosen a trait that is NOT synapomorphic and mapped it onto the tree position 10 the trait in question is an A in the lizard and two species of Brookesia and transitions to G in Chamaeleo After mapping all of the synapomorphic traits count the total number of trait transitions required to support this tree and note this number next to your tree If you are not sure which traits are synapomorphic read the material in the tan box that starts on page 214 of the text and is entitled Phylogenies from DNA sequences NOTE the tree only shows the three chameleon species leaving out the lizard Uromastyx outgroup that is included in the DNA data so you can evaluate which base is ancestral for each position Uromastyx B theili B brygooi C feae 10 T 20 1 30 1 40 1 50 AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCOCACAACAAACACAATTT Brookesia theili

Use the given chapter titles below to organize what happens in the story in order Additionally provide a piece of information that helps to explain the title or what is learned from the narrator that will help you remember the major plot event from the chapter story Note This assignment is not simply about putting the titles in order Allie s Glove Packing Up and Leaving Pencey Ernie s Piano Bar Sunny Ackley and His Lousy Teeth The Edmont Hotel of Perverts Stradlater Gets Ready For His Date Life at the Museum

cm 0 RESET MY NOTES 3 4 ALA Lab Data Time min 10 20 30 Time min 0 10 0 20 0 30 Diffusion Spot Diameter 1 Crystal mm 13 16 16 Rate of Diffusion for 1 Crystal mm hr Diffusion Spot Diameter 3 Crystals mm 19 23 27 Rate of Diffusion for 3 Crystals mm hr How to Measure Diffusion Spot Diameter 6 Crystals mm 20 29 X 37 Rate of Diffusion for 6 Crystals mm hr Rate mm h diameter mm time min x 60 min 5 6 7 Diffusion Rate Complete the following T TOUC One orystur m tweezers Place three crystals using tweezers Place six crystals int using tweezers A tim once all three dishes crystals Timer will pause at 10 the ruler to measure t spot diameter for eac Record in Lab Data Timer will pause at 20 Measure the diffusion diameter for each dish Record in Lab Data Timer will pause at 30 Measure the diffusion diameter for each dish Record in Lab Data Calculate diffusion rate time dish entry Recorc

Per course policy on academic honesty reproduction or dissemination of this Use Table 2 to answer questions 5 through 8 You are a researcher evaluating the relationship of fingernail length to the microbial population underneath the nail after handwashing You have 12 volunteers 6 of which have short natural nails and 6 with longer artificial nails Both nail type groups are exposed to E coli JM109 and FCV The participants wash their hands using the same handwashing procedures and researchers determine the microbial population after handwashing The cumulative data is in the table below TABLE 2 Average counts of E coli JM109 log CFU per volunteer SD and FCV log TCID so per volunteer SD beneath fingernails before and after hand washing for all six hand washing procedures combined E coli JM109 Nail type Natural Artificial Before hand washing 6 17 0 59 A 6 57 0 47 B Before hand washing 3 06 0 47 A 3 69 0 52 B FCV After hand washing 4 11 0 47 A 4 81 0 85 B Average counts followed by different letters in the same column were significantly different P 0 05 Significant differences in E coli JM109 and FCV counts between the two nail types were determined by t test After hand washing 1 15 0 75 A 2 18 0 98 B Lin C M Wu F M Kim H K Doyle M P Michaels B S amp Williams L K 2003 A comparison of hand washing techniques to remove Escherichia coli and caliciviruses under natural or artificial fingernails Journal of Food Protection 66 5 Write a hypothesis that would have been supported because of this study 1 pt 8 Based on the table what can you conclude 1 pt 6 What are the independent and dependent variables What is the control group Why are control groups important 4 pts 7 What is one constant variable mentioned in the paragraph describing the study 1 pt

Make the following solution 75mL 10X TBE 9M Tris Base 889M Boric acid 20mM EDTA You are Given Solid Tris 121 g mol and Boric Acid 61 8g mol You are given 5M EDTA

What is the significance of the Baltimore classification How might we be able to use this type of classification to learn more about viruses or ways to target them for treatments Rubrics

Here is an example JIGSAW slide We do not have a Group 1 so this is the Group assignment for Article 1 Reduced Permeability Darby E M Trampari E Siasat P et al Molecular mechanisms of antibiotic resistance revisited Nat Rev Microbiol 21 280 295 2023 GRAM NEGATIVE GRAM POSITIVE Purpose The purpose of this section was to discuss the bacterial adaptations to prevent antibiotics from crossing the cell membrane This section discusses Gram positive and negative mechanisms for reducing membrane permeability Concept Antibiotics usage has reduced cell permeability bacteria have evolved ways to prevent antibiotics from entering the cell The antibiotics cannot pass the cellular membranes of both Gram positive and negative cells which is a pathogenic tactic for resisting antibiotics Examples In some Gram negative species Enterobacterales E coli K pneumoniae porin channels have been modified to prevent larger molecules antibiotics from entering the cell P aeruginosa and A baumannii produce only small porins making their outer membranes highly impermeable Some pathogenic Gram positive bacteria have changed the composition of the cytoplasmic membrane which reduces permeability of the antibiotics

is the significance of the Baltimore classification How might we be able to use this type of classification to learn more about viruses or ways to target them for treatments

Choose which of the following apply to complexity and body size by using the figure below Present 100 200 Origin of earth 300 400 600 Million 800 years ago 17 Billion years ago 3 4 First eukaryote to cre Bacteria 1 10 100 um um um Cyanobacteria Living Amphibian Fish Eurypterid p Dinosaur Trilobite 1 10 100 mm mm mm Length Whale 1 10 100 m m m Many of these larger animals have different internal transport systems in order to survive in comparison to smaller animals Most complex grades of animal organization can promote evolution of large body size A large animal has more surface area relative to its volume than a small animal of the same shape

It s amazing how much money you can save by buying ground beef in bulk James observed He and Albert were driving home after their Saturday morning shopping trip True said Albert but I m not sure we have enough space in the freezer to store it all That s not necessary said James We don t have to freeze it We can just keep it in the fridge As long as we set the temperature control low enough the meat will be fine No it won t replied Albert we must divide it up into smaller servings and freeze everything we don t use today Never mind said James I ll take care of it Once they got home James spent some time reorganizing the freezer so that the 5 pound package of ground beef fit Over the next few weeks they would thaw it out in the refrigerator overnight take what they needed for the day and then put the rest back in the freezer One evening both James and Albert developed stomach cramps and diarrhea You see moaned Albert I told you that we should have divided the beef up so that each portion was only thawed out once Nonsense said James doubled over with cramps it couldn t have been the beef Freezing kills all the microbes that cause disease I learned in class that most microbes that cause disease in people are mesophiles and they grow best at body temperature This must be something else 1 Can microbes survive freezing 2 Does thawing meat in the fridge provide enough protection from potential pathogens 3 What would have been a better approach to prevent the roommates discomfort

2 3 4 5 6 Background Research Divide Paper by Topics Outlining Note taking Annotated bibliographies Starting point zing information for Academic Writing A In this tutorial you will learn how to synthesize information for academic writing in a variety of different disciplines that you may come across within your coursework at CSUB Click here to view tutorial in new tab best for mobile users Access Login Access is restricted to CSUB students currently enrolled faculty and staff Enter your NetID Password then click the Login button myCSUB NetID Password Login Clear Lookun NetID Reset Change Password DO NOT INCLUDE csub edu

Viruses of Repute Describe viral structure How is Senetic information encoded What are the potential hosts of a virus How would we culture viruses Figure 1 A general viral particle 3 Examine the diagram below depicting viral infection of a typical cell a Describe what is happening in each of the five steps b What are the roles of the two cellular factors shown on the diagram Figure 2 A general viral life cycle Attachment w m Entry w 3333 ww Nucleus w m ww wm Synthesis Assembly Release

Adaptation Yolk Sac Utilization in Fish Larvae a How it works Fish larvae heavily rely on the yolk sac for nourishment during the early stages of development The yolk sac is a specialized structure containing nutrient rich resources transferred from the egg As the larvae grow they gradually absorb and utilize these nutrients from the yolk sac b Benefit to the organism This adaptation provides a crucial energy source for fish larvae supporting their growth and development in the initial stages of life The yolk sac allows them to sustain themselves before transitioning to external food sources enhancing their survival chances c Peer reviewed citation Jones G P McCormick M I Srinivasan M Eagle J V 2004 Coral decline threatens fish biodiversity in marine reserves Proceedings of the National Academy of Sciences of the United States of America 101 21 8251 8253

Part II If your goal is to characterize the ETPUM whose results are more informative yours or your boss s Why What do your results indicate about the nature of this microbe Does its biochemical composition most closely resemble that of a Gram positive or Gram negative organism Cheker DNA DIGA RNA R Nu O Gram positive Gram negative

This is a map of Permian age geography Discuss the contrast with how a modern map would look Bring in concepts of rifting and vicariance to explain these contrasts South America Cynognathus Africa India 2 Antarctica Lystrosaurus W Glossopteris Australia

Jan 15 Jan 21 Must post first How would the use of bacteriocidal bacteriostatic or bacteriolytic antimicrob agents differ in their resulting cell counts total and viable How would the ef differ regarding the growth curve of the cells Use examples to support your

How do prokaryotic cells exhibit cellular differentiation Describe one manner of differentiation and the purpose of such differentiation You must start a thread before you can read and reply to other threads

SAFAT RENK Using the figures Figur 3 28 book respectively as a starting point create a flowchart that indicates the basic steps of cell division and replisome movement in a dividing cell for both a rod shaped and a spherical cell Highlight differences in the process that are dependent upon cell morphology Include the bolded key terms from Section 3 4 of the book NEAR BR MILITACRILATES Origin of replication DNA origin replicates and gras DNA replication continues bideectionally DNA starts next round Septum forms 2 ring Division into two cel Terminator sequence Origin of replication Two plomes Fiz uma Zring Torminator aquanon Fact in cytoplasm Zring Old pole New pole New pole is now old 18 Copyright 2020 W W Norton Company lec Copyright 2020 W W Norton Company Inc After creating your flowchart answer the following New poles New polos are now nid Old pole Cell growth Beginning of cell division Old pole

Eukaryotic cell walls contain peptidoglycan O True False

Which of the following types of cell walls is are made up of many layers of peptidoglycan none of the choices are correct O acid fast O Gram negative O Gram positive

day I want to talk about Mating Position in Bombay Night Frogs An Unconventional Approach 1 Our exploration today delves into the Bombay Night Frog Nyctibatrachus humayuni and its unique mating position known as dorsal straddling Unlike typical frog amplexus where the male clasps the female from behind Bombay Night Frogs engage in a peculiar dorsal straddling position with the male perching atop the female II This adaptation is particularly intriguing because it allows for a more efficient transfer of sperm The dorsal straddling position ensures that the male s sperm is directly deposited on the female s cloacal opening enhancing the chances of successful fertilization This unconventional mating adaptation in Bombay Night Frogs adds a captivating layer to our discussions on amphibian reproduction and showcases the diverse strategies employed by different species