Biomolecules Questions and Answers

NAME Compin Castaneda Worksheet 26 Protein Synthesis PART B Answer the following 1 Complete the table CODON PART A Match each term with the correct description by writing the letters on the lines provided 1 group of three bases on tRNA a ribosome 2 group of three bases on mRNA b anticodon 3 building block of proteins c nucleus 4 d codon 5 site where DNA is transcribed organelle used in translation product of translation e amino acid 6 f mRNA 7 product of transcription g protein GCA UUU ACC CLASS per 2 2 Describe the role of tRNA in translation MATCHING ANTICODON a b DATE Protein Synthesis Play C
Biology
Biomolecules
NAME Compin Castaneda Worksheet 26 Protein Synthesis PART B Answer the following 1 Complete the table CODON PART A Match each term with the correct description by writing the letters on the lines provided 1 group of three bases on tRNA a ribosome 2 group of three bases on mRNA b anticodon 3 building block of proteins c nucleus 4 d codon 5 site where DNA is transcribed organelle used in translation product of translation e amino acid 6 f mRNA 7 product of transcription g protein GCA UUU ACC CLASS per 2 2 Describe the role of tRNA in translation MATCHING ANTICODON a b DATE Protein Synthesis Play C
Biohazardous Waste includes Select one O Body fluids and body parts O Blood and blood products Animal wastes All answers are correct
Biology
Biomolecules
Biohazardous Waste includes Select one O Body fluids and body parts O Blood and blood products Animal wastes All answers are correct
Factors affecting the performance of the glove in a specific case include Select one O Material thickness size and location of the lab O Material thickness chemical resistance and atmospheric pressure O Chemical resistance size and material thickness O Amount of hand flex location of the lab and cost of the glove
Biology
Biomolecules
Factors affecting the performance of the glove in a specific case include Select one O Material thickness size and location of the lab O Material thickness chemical resistance and atmospheric pressure O Chemical resistance size and material thickness O Amount of hand flex location of the lab and cost of the glove
is any substance which speeds up the rate of a chemical reaction are considered both proteins and organic catalysts 1 A 2 All 3 To do its job an enzyme binds to a molecule called a 4 The energy required for a chemical reaction to occur is called the 5 vitamins and enzyme fit better with its substrate 6 An enzyme binds to a substrate at the 7 The 8 The energy metal ions bind to a substrate and help an model of enzyme action states that enzymes are specific to one substrate model of enzyme action states that enzymes change shape slightly when they bind to their substrate 9 When factors such as temperature or pH get too high an enzyme will shape or change Part II Diagram Labeling Using the word bank label the diagram of the model of enzyme action
Biology
Biomolecules
is any substance which speeds up the rate of a chemical reaction are considered both proteins and organic catalysts 1 A 2 All 3 To do its job an enzyme binds to a molecule called a 4 The energy required for a chemical reaction to occur is called the 5 vitamins and enzyme fit better with its substrate 6 An enzyme binds to a substrate at the 7 The 8 The energy metal ions bind to a substrate and help an model of enzyme action states that enzymes are specific to one substrate model of enzyme action states that enzymes change shape slightly when they bind to their substrate 9 When factors such as temperature or pH get too high an enzyme will shape or change Part II Diagram Labeling Using the word bank label the diagram of the model of enzyme action
7 An insertion or deletion can result in a frameshift mutation To demonstrate this complete the following Note You will need a codon chart DNA mRNA Amino Acids DNA mRNA GCA Amino Acids Deletion causing a frameshift Taking out the first G in the original DNA above results in Normal Strand ATG CAA Amoeba Sisters Videc 8 TGC CAC AC How did the frameshift change the amino acids Chromoso Ske
Biology
Biomolecules
7 An insertion or deletion can result in a frameshift mutation To demonstrate this complete the following Note You will need a codon chart DNA mRNA Amino Acids DNA mRNA GCA Amino Acids Deletion causing a frameshift Taking out the first G in the original DNA above results in Normal Strand ATG CAA Amoeba Sisters Videc 8 TGC CAC AC How did the frameshift change the amino acids Chromoso Ske
Yeast is secreting CO2 causing bubbles in the dough Bacteria is eating up some of the gluten Bacteria secreting lactic acid is breaking up the gluten Yeast is secreting alcohol and dissolving the gluton
Biology
Biomolecules
Yeast is secreting CO2 causing bubbles in the dough Bacteria is eating up some of the gluten Bacteria secreting lactic acid is breaking up the gluten Yeast is secreting alcohol and dissolving the gluton
Where can you find more information on how FIU manages hazardous chemical waste O Emergency Management Plan Bloodborne Pathogen Exposure Plan Hazardous Waste Management Plan
Biology
Biomolecules
Where can you find more information on how FIU manages hazardous chemical waste O Emergency Management Plan Bloodborne Pathogen Exposure Plan Hazardous Waste Management Plan
The SARA Act amended CERCLA to include more Select all that apply O Insurance coverage O Ecological surveys Addition of more hazardous waste sites Citizen participation Stato involvement
Biology
Biomolecules
The SARA Act amended CERCLA to include more Select all that apply O Insurance coverage O Ecological surveys Addition of more hazardous waste sites Citizen participation Stato involvement
EH S provides a general hazardous awareness training or lab safety training online Who is responsible to provide lab specific hazard awareness training for all lab personnel Select one O PI Supervisor O There is no specific lab hazard awareness training Department chair
Biology
Biomolecules
EH S provides a general hazardous awareness training or lab safety training online Who is responsible to provide lab specific hazard awareness training for all lab personnel Select one O PI Supervisor O There is no specific lab hazard awareness training Department chair
How long must the FIU Hazardous Waste Pickup Forms signed by the Waste Coordinator be maintained by the department PI or Laboratory Manager and be immediately available to University State Federal and EH S Compliance Officers Select one O Five Years O Three Years Two Years O Four Years O One year
Biology
Biomolecules
How long must the FIU Hazardous Waste Pickup Forms signed by the Waste Coordinator be maintained by the department PI or Laboratory Manager and be immediately available to University State Federal and EH S Compliance Officers Select one O Five Years O Three Years Two Years O Four Years O One year
Containers of hazardous waste may be stored inside laboratory fume hoods when Select one Containers are inside a chemically compatible secondary containment of appropriate size O When the hood does not contain a sink The hood is being used exclusively for the storage of hazardous waste O All answers are correct
Biology
Biomolecules
Containers of hazardous waste may be stored inside laboratory fume hoods when Select one Containers are inside a chemically compatible secondary containment of appropriate size O When the hood does not contain a sink The hood is being used exclusively for the storage of hazardous waste O All answers are correct
Broken glass disposable gloves used absorbent and other contaminated cleanup supplies from a hazardous spill must be Select one Placed in a plastic bag and put in the lab waste storage area O Collected in a compatible puncture resistant container labeled and treated as a Hazardous Waste Spill Clean up debris Put in regular trash O Placed in the broken glass container box O Put in the trash dumpster
Biology
Biomolecules
Broken glass disposable gloves used absorbent and other contaminated cleanup supplies from a hazardous spill must be Select one Placed in a plastic bag and put in the lab waste storage area O Collected in a compatible puncture resistant container labeled and treated as a Hazardous Waste Spill Clean up debris Put in regular trash O Placed in the broken glass container box O Put in the trash dumpster
Hazardous wastes are classified into two categories Select one O Listed Industrial O Industrial Environmental Charact
Biology
Biomolecules
Hazardous wastes are classified into two categories Select one O Listed Industrial O Industrial Environmental Charact
Full Clean glass waste containers blue boxes are disposed by placing them into the waste dumpster regular trash by Select one O Laboratory personnel who generated the waste O An agency contracted to dispose glass waste O Custodial Personnel O Facilities maintenance personnel O Environmental Health and Safety EH S
Biology
Biomolecules
Full Clean glass waste containers blue boxes are disposed by placing them into the waste dumpster regular trash by Select one O Laboratory personnel who generated the waste O An agency contracted to dispose glass waste O Custodial Personnel O Facilities maintenance personnel O Environmental Health and Safety EH S
Persons preparing and signing the Pick up Request Form are required to take the following training Select one O Hazard Communication HAZCOM O None are correct All are correct except the none are correct option O Fire Safety EPA Hazardous Waste Awareness and Handling PPE Laboratories
Biology
Biomolecules
Persons preparing and signing the Pick up Request Form are required to take the following training Select one O Hazard Communication HAZCOM O None are correct All are correct except the none are correct option O Fire Safety EPA Hazardous Waste Awareness and Handling PPE Laboratories
Cryogenic gases should be stored or used in O Confined spaces None of the answers are correct A well ventilated area Spaces with poor ventilation
Biology
Biomolecules
Cryogenic gases should be stored or used in O Confined spaces None of the answers are correct A well ventilated area Spaces with poor ventilation
The following information must be stamped on the cylinder O DOT specification and serial number DOT specification O Barcode Serial number
Biology
Biomolecules
The following information must be stamped on the cylinder O DOT specification and serial number DOT specification O Barcode Serial number
Once you are done with a gas cylinder you should O Take it to a dumpster for disposal O Leave it
Biology
Biomolecules
Once you are done with a gas cylinder you should O Take it to a dumpster for disposal O Leave it
When must you separate cylinders Select ALL that apply When they are different colors When they are flammable and oxidizers O When they are new When they are full or empty
Biology
Biomolecules
When must you separate cylinders Select ALL that apply When they are different colors When they are flammable and oxidizers O When they are new When they are full or empty
Which carbon on the deoxyribose sugar connects to the phosphate group 41116 HO P O phosphate Carbon 1 Carbon 2 Carbon 3 O Carbon Carbon S N OH H deoxyribose sugar H N N base S CH OH 3 21 OH H deoxyribose OH
Biology
Biomolecules
Which carbon on the deoxyribose sugar connects to the phosphate group 41116 HO P O phosphate Carbon 1 Carbon 2 Carbon 3 O Carbon Carbon S N OH H deoxyribose sugar H N N base S CH OH 3 21 OH H deoxyribose OH
Consider the reaction A B C D Under standard conditions at equiliubrium the concentrations of the compounds are A 0 1 M B 0 1 M C 1 9 M and D 1 9 M and the pH is 7 0 Keq for the reaction is and the reaction is you do not need a calculator for this 361 endergonic 0 00277 endergonic 361 exergonic 0 00277 exergonic
Biology
Biomolecules
Consider the reaction A B C D Under standard conditions at equiliubrium the concentrations of the compounds are A 0 1 M B 0 1 M C 1 9 M and D 1 9 M and the pH is 7 0 Keq for the reaction is and the reaction is you do not need a calculator for this 361 endergonic 0 00277 endergonic 361 exergonic 0 00277 exergonic
QUESTION 6 G alpha is not only an activator of Adenylate cyclase but it is a GTPase How does mutation in G alpha th GTPase activity affect liver cell responses to epinephrine All of the above It would decrease protein kinase A activity It would decrease proliferation O It would increase secretion of epinephrine It would increase glycogen phosphorylase activity
Biology
Biomolecules
QUESTION 6 G alpha is not only an activator of Adenylate cyclase but it is a GTPase How does mutation in G alpha th GTPase activity affect liver cell responses to epinephrine All of the above It would decrease protein kinase A activity It would decrease proliferation O It would increase secretion of epinephrine It would increase glycogen phosphorylase activity
Liver cells respond to epinephrine by O Producing ATP Increasing the rate of glycogen synthesis Breaking down glycogen Secreting the hormone glucagon which makes you feel hungry
Biology
Biomolecules
Liver cells respond to epinephrine by O Producing ATP Increasing the rate of glycogen synthesis Breaking down glycogen Secreting the hormone glucagon which makes you feel hungry
biology II You are a researcher studying the
Biology
Biomolecules
biology II You are a researcher studying the
What is the first step in amending the constitution O Both houses of Congress must approve to make it a formal process O It must be ratified by the states O Thinking of an idea O It must pass judicial review
Biology
Biomolecules
What is the first step in amending the constitution O Both houses of Congress must approve to make it a formal process O It must be ratified by the states O Thinking of an idea O It must pass judicial review
3 What is the sequence of DNA that is complementary to the coding sequence of DNA given below coding DNA complementary DNA ATTACGATCTGCACAAGATCC
Biology
Biomolecules
3 What is the sequence of DNA that is complementary to the coding sequence of DNA given below coding DNA complementary DNA ATTACGATCTGCACAAGATCC
Imagine you walk into lab after spring break and your TA hands you a beaker containing a solution of A B and C in water represented by the equilibrium shown below If the solution has reached equilibrium and the beaker is at pH 7 0 25 C and 1 atm pressure what other information do you need to obtain in order to calculate AG for this reaction A B C The mechanism of the reaction The density of the solution All of the above The molecular weights of A B and C The concentrations of A B and C
Biology
Biomolecules
Imagine you walk into lab after spring break and your TA hands you a beaker containing a solution of A B and C in water represented by the equilibrium shown below If the solution has reached equilibrium and the beaker is at pH 7 0 25 C and 1 atm pressure what other information do you need to obtain in order to calculate AG for this reaction A B C The mechanism of the reaction The density of the solution All of the above The molecular weights of A B and C The concentrations of A B and C
Archeological evidence suggests that Neanderthals may have been aware of the medicinal properties of plants over 60 000 years ago Imagine you are a modern day ethnobotanist and have identified a compound from fossilized tree pollen that binds to the alpha subunit of the most common G proteins To test how the compound affects the activity of Ga you treat liver cells with the compound alongside epinephrine You observe that the cells fail to produce glucose Which of the following could be how the compound acts It could inhibit the GTPase activity of Ga It could decrease the affinity of Ga for GDP It could cause Ga to bind more tightly to adenylate cyclase None of the above
Biology
Biomolecules
Archeological evidence suggests that Neanderthals may have been aware of the medicinal properties of plants over 60 000 years ago Imagine you are a modern day ethnobotanist and have identified a compound from fossilized tree pollen that binds to the alpha subunit of the most common G proteins To test how the compound affects the activity of Ga you treat liver cells with the compound alongside epinephrine You observe that the cells fail to produce glucose Which of the following could be how the compound acts It could inhibit the GTPase activity of Ga It could decrease the affinity of Ga for GDP It could cause Ga to bind more tightly to adenylate cyclase None of the above
Which of the following is an advantage of multicellularity O Greater mobility Increased stability O Shorter generation times Easier to absorb nutrients
Biology
Biomolecules
Which of the following is an advantage of multicellularity O Greater mobility Increased stability O Shorter generation times Easier to absorb nutrients
8 One difference between a postmortem injury and per mortem injury is O Postmortem injuries have sharp jagged edges with hinging Only postmortem injuries have no sign of healing O Postmortem injuries are lighter in color compared to the rest of the bone O Postmortem injuries have signs of healing
Biology
Biomolecules
8 One difference between a postmortem injury and per mortem injury is O Postmortem injuries have sharp jagged edges with hinging Only postmortem injuries have no sign of healing O Postmortem injuries are lighter in color compared to the rest of the bone O Postmortem injuries have signs of healing
individuals O There is more genetic variation within an ancestral group than between different ancestral groups ancestry as a category to classify There is more genetic variation between different ancestral groups than within an ancestral group O Humans don t have enough genetic markers to use to compare with each other 6 There has been very little admixture between populations throughout human history True False 1P 1 point
Biology
Biomolecules
individuals O There is more genetic variation within an ancestral group than between different ancestral groups ancestry as a category to classify There is more genetic variation between different ancestral groups than within an ancestral group O Humans don t have enough genetic markers to use to compare with each other 6 There has been very little admixture between populations throughout human history True False 1P 1 point
5 Which type of skeletal injury could be from a homicide antemortem Operimortem O postmortem 6 Injury on skeleton made from carnivores and scavengers gnawing on bone O antemortem Operimortem postmortem poim count
Biology
Biomolecules
5 Which type of skeletal injury could be from a homicide antemortem Operimortem O postmortem 6 Injury on skeleton made from carnivores and scavengers gnawing on bone O antemortem Operimortem postmortem poim count
Despite having the nine states needed to ratify the Constitution some Framers still feared a lack of general acceptance without the support of which two important states O New York and Virginia New York and Pennsylvania O Virginia and Pennsylvania O New York and Delaware
Biology
Biomolecules
Despite having the nine states needed to ratify the Constitution some Framers still feared a lack of general acceptance without the support of which two important states O New York and Virginia New York and Pennsylvania O Virginia and Pennsylvania O New York and Delaware
Question 7 Points 1 Anti Federalists feared Ofree enterprise O centralized authority O individual rights O strong state governments Complete Late
Biology
Biomolecules
Question 7 Points 1 Anti Federalists feared Ofree enterprise O centralized authority O individual rights O strong state governments Complete Late
How many of the 13 colonies were needed to ratify the U S Constitution 13 07 O 10 09
Biology
Biomolecules
How many of the 13 colonies were needed to ratify the U S Constitution 13 07 O 10 09
If you had a patient in which the lung epithelium was leaking fluids from the bloodstream into the lumen of the lung which of the following is the most likely cause A mutation in an extracellular matrix protein O High levels of cholesterol A mutation in a cell adhesion molecule A mutation in actin
Biology
Biomolecules
If you had a patient in which the lung epithelium was leaking fluids from the bloodstream into the lumen of the lung which of the following is the most likely cause A mutation in an extracellular matrix protein O High levels of cholesterol A mutation in a cell adhesion molecule A mutation in actin
Liver cells respond to epinephrine by breaking down glycogen What is the second messenger in this patway ATP Acetylcholine cyclic AMP Adenine
Biology
Biomolecules
Liver cells respond to epinephrine by breaking down glycogen What is the second messenger in this patway ATP Acetylcholine cyclic AMP Adenine
D Question 14 During mitosis in animal cells at which phase do centrioles begin to move apart O anaphase O telophase O metaphase O prophase
Biology
Biomolecules
D Question 14 During mitosis in animal cells at which phase do centrioles begin to move apart O anaphase O telophase O metaphase O prophase
Question 9 The complex of DNA and protein that makes up a eukaryotic chromosome is properly called O a centrosome O a chromatid O a centromere O chromatin h
Biology
Biomolecules
Question 9 The complex of DNA and protein that makes up a eukaryotic chromosome is properly called O a centrosome O a chromatid O a centromere O chromatin h
Question 5 Points 2 Which of the following statement s about Philadelphia convention is are TRUE The Federal Convention convened in the State House Independence Hall in Philadelphia on May 14 1787 to revise the Articles of Confederation The delegations from only two states were at first present the members adjourned from day to day until a quorum of seven states was obtained on May 25 Through discussion and debate it became clear by mid June that rather than amend the existing Articles the Convention would draft an entirely new frame of government All of the choices 10
Biology
Biomolecules
Question 5 Points 2 Which of the following statement s about Philadelphia convention is are TRUE The Federal Convention convened in the State House Independence Hall in Philadelphia on May 14 1787 to revise the Articles of Confederation The delegations from only two states were at first present the members adjourned from day to day until a quorum of seven states was obtained on May 25 Through discussion and debate it became clear by mid June that rather than amend the existing Articles the Convention would draft an entirely new frame of government All of the choices 10
Question Points 1 Which of the following is NOT another name for the United States Constitutional Convention The Third Continental Congress O The Philadelphia Convention The Federal Convention O The Grand Convention at Philadelphia Complete Later Complete 5 9
Biology
Biomolecules
Question Points 1 Which of the following is NOT another name for the United States Constitutional Convention The Third Continental Congress O The Philadelphia Convention The Federal Convention O The Grand Convention at Philadelphia Complete Later Complete 5 9
You have an unknown plant sample The plant has very few stomata and they open only at night You conclude that the plant must live in a night to gather humid carbon dioxide Odry carbon dioxide dry oxygen wet oxygen habitat and it opens its stor
Biology
Biomolecules
You have an unknown plant sample The plant has very few stomata and they open only at night You conclude that the plant must live in a night to gather humid carbon dioxide Odry carbon dioxide dry oxygen wet oxygen habitat and it opens its stor
Question Completion Status QUESTION 4 You are interested in the regulation of gene Q Proteins G H and J are protein fashion Proteins G and H both bind to site A but cannot bind to site A at the A B m
Biology
Biomolecules
Question Completion Status QUESTION 4 You are interested in the regulation of gene Q Proteins G H and J are protein fashion Proteins G and H both bind to site A but cannot bind to site A at the A B m
A group behavior is advantageous only if which two things are true A The behavior poses no risk to any individuals in the group B The behavior prevents competition among individuals C The behavior supports the survival of the members of the group D The behavior increases the chances of successful reproduction
Biology
Biomolecules
A group behavior is advantageous only if which two things are true A The behavior poses no risk to any individuals in the group B The behavior prevents competition among individuals C The behavior supports the survival of the members of the group D The behavior increases the chances of successful reproduction
on 12 If you exposed a protein solution to the enzyme pepsin you could test for the activity of this enzyme by using a Benedict s solution b Coomassie c iodine place letter corresponding to answer on answer sheet the
Biology
Biomolecules
on 12 If you exposed a protein solution to the enzyme pepsin you could test for the activity of this enzyme by using a Benedict s solution b Coomassie c iodine place letter corresponding to answer on answer sheet the
equation oig a moil 13 pH pKa log A HA is known as the w ver
Biology
Biomolecules
equation oig a moil 13 pH pKa log A HA is known as the w ver
RT 1 Supply the correct word or phrase that completes the statement 1 An enzyme is a
Biology
Biomolecules
RT 1 Supply the correct word or phrase that completes the statement 1 An enzyme is a
2 Why do you think the European Union would be a major influence for immigrants to relocate to countries within Europe
Biology
Biomolecules
2 Why do you think the European Union would be a major influence for immigrants to relocate to countries within Europe
Which of these is an opinion It s All Online article An opinion tells what a person thinks or feels Others may not think this is right A Some websites save people s credit card information B Three billion Yahoo e mail were hacked in 2013 C People give companies information when they shop online D It is smart for people to give up social media and e mail
Biology
Biomolecules
Which of these is an opinion It s All Online article An opinion tells what a person thinks or feels Others may not think this is right A Some websites save people s credit card information B Three billion Yahoo e mail were hacked in 2013 C People give companies information when they shop online D It is smart for people to give up social media and e mail
Which two words have opposite meanings A Information and data B Breach and problem C Give and receive D Record and keep
Biology
Biomolecules
Which two words have opposite meanings A Information and data B Breach and problem C Give and receive D Record and keep