Biomolecules Questions and Answers
Biology
Biomoleculesand 1 blotting immunoblotting by placing the phrases to the technique that they describe If a phrase describes both ELISA and western blotting place it under Both ELISA Western blot with SDS PAGE Answer Bank Both
Biology
BiomoleculesWhich of the following statements accurately describe a chromosome Select the THREE 3 that apply Chromosomes contain more than one DNA molecule linked together and then tightly wound Chromosomes contain one long DNA molecule that is tightly wound Every chromosome has many genes and each gene is one segment of DNA Each chromosome has one gene as the entire segment of DNA which makes up a gene In any given organism the gene s found on one chromosome can also be found on other chromosomes There may be two different versions of the same gene on different chromosomes
Biology
BiomoleculesFacilitated diffusion requires the use of channel proteins to transport across the cell
Biology
BiomoleculesLL LUES Tools Help gine researchers following up on Seeley s study brought some flat pe bility What results could they observe that would support the hypoth results they could directly observe without using molecular techniqu abels to the target that correctly answers each question s phrases onto the lines below to compose your answer ERS ys Section 5 Testing For Natural Selection Darwinian Snails his is good evidence that shell thickness is heritable ly 6 8 CRITTERS all snails some snails RESULT increase s in average she grow thicker she have thin shelled of
Biology
BiomoleculesWhich of the following symptoms of alcohol withdrawal can be best described as convincing sensory experiences that occur in the absence of an external stimulus Multiple Choice O insomnia hallucinations tremors
Biology
BiomoleculesQ6 10 Horned lizards use their horns to defe that lizards living in areas with predatory bird predatory birds This observation led her to h against predation than do shorter horns To t lizards with long horns and 20 lizards with sh where there are no predatory birds and Cact returned every week for 12 weeks to measure
Biology
BiomoleculesNO VARIATION in shell thickness opens to shell thickness in respons ess does not evolve in the population ess evolves for some snails in the pop ess increases for all snails in the popu
Biology
BiomoleculesName of bond it can form with another atom Give an example Give a description what happens with electrons
Biology
BiomoleculesMake a diagram of the following atoms use lecture notes as a template 1 Nitrogen atomic 7 atomic mass 14 Label protons neutrons and electrons Show their charges 3 Explain how do you know Nitrogen is a non metal that it has 5 electrons in the outmos shell and in order to obtain stability it needs 3 more electrons Name this type of bond triple covalent bond Give a brief description what happens with the electrons of bonds it can form 7P 7N 3 empty spaces in the outmost shell bonds with It can other atoms
Biology
Biomoleculesnot look different Submit JE VVCII aller fla Q6 6 Which of the following is REQUIRED occur Offspring must be similar to their parents There must be a sudden environmental ch
Biology
BiomoleculesMatch each word with its definition description Famine Malnourishment Undernourishment Extreme scarcity of food affecting an entire region Diet does not meet an individual s energy requirements An absence of one or more micronutrients within an individu diet
Biology
BiomoleculesPersistent pesticides undergo choose your answer choose your answer meaning they become more concentrated as they move up a food chain meaning they build up in an organism s tissues over time They may also undergo
Biology
BiomoleculesMatch each type of erosion with its definition description Splash erosion Sheet erosion Rill Gully erosion Water forms channels as it carries soil away Raindrops hit bare soil loosening it A sheet of water flows over the ground removing a layer of
Biology
Biomoleculessignificantly to the child s adjustment to ablended family O Yes O No Question 8 1 pts Children generally adjust better to a stepparent after the death of a natural parent than after a divorce
Biology
BiomoleculesUsing the soil texture triangle how would soil with the following composition be classified 50 sand 20 clay 80 silt 10 100 20 30 sand 90 Clay 40 50 loamy sand 60 70 sandy clay sandy clay loam 80 sandy loam 80 90 60 100 clay clay loam loam 10 50 Silty Clay Loam Silt Loam Sand 40 40 silty clay silt loam 30 Silt silty clay loam 20 q silt 10 6 100
Biology
BiomoleculesWhat is an agricultural ecosystem O A description of cumulative practices within a farm for food growth nutrient replacement and pest control Complex integrated living system of climate plants local animals soil nutrients and what is being grown A description of the types of food crops grown on a farm O A description of natural uncultivated areas that surround a farm
Biology
BiomoleculesWhich of the following is a concern raised by our course texts about the health safety and well being of egg donation for ART IVF purposes Psychological stress effects of egg donation Avoiding exploitation of donor s reproductive labor in exchange for money All answers are correct Health risks associated with drugs used to stimulate ovulation Egg ownership concerns i e Who owns the eggs once harvested The donor The consumer
Biology
BiomoleculesAccording to Alison Piepmeier the mainstream approach to disability and selective abortion including some feminist approaches reinforces stereotypes about disability How All answers are correct It promotes a view of disabilities as diseases that should be eradicated It promotes a very limited view of disability as inevitably and uniquely tragic The emphasis on individual choice for pregnant women overlooks the fact that culture and community influence the process of decision making What defines a disability vs the norm is presented as a natural given while both are in fact social constructs
Biology
BiomoleculesThe statements below are true for proteins statement is true only for enzymes Check the Protein column when the statement is true about other types of proteins Some statements will have both boxes checked Statements 1 Names end with ase 2 Contains amine groups 3 Are macromolecules with peptide bonds 4 Causes browning in cut fruit 5 Names end with in 6 Are denatured by heat 7 Can change the texture of foods 8 Functions as a gelling agent 9 Acts as a catalyst 10 Aids in digestion 11 Builds and repairs body tissue 12 Reacts with a substrate 13 Also called a polypeptide 14 Can be an emulsifier 15 Helps clarify fruit juice 16 Can be reused thousands of times per minute 17 Provides energy 18 Controls chemical activity in living organisms 19 Lowers activation energy 20 Is denatured by low or high pH 21 Is denatured by mechanical action 22 Aids in foam formation 23 Can convert one food product into another 24 Is used to extract food components from food systems 0 Con break down indigestible cellulose Enzyme Protein f
Biology
BiomoleculesWhich of these are threats to validity in the study Professor Jones wants to study aggression in preschool children He predicts that children from poorer incomes will be more aggressive than children from richer backgrounds So he contacts all his friends who have preschool children and from this group he assembles a sample of 20 children ranging in age from 2 years to 5 years After asking their parents how much their yearly income level is Professor Jones observes each child at play in their local playground He counts the number of times that child hits another child Since he gets observe an equal number of rich and poor children hitting others he concludes that poor children are as aggressive as rich children small sample owing biased sample
Biology
BiomoleculesWhat is the independent variable in the hypothesis The foot in the door selling technique is more effective than the limited time offer selling technique sales technique Osales effectiveness foot in the door How much someone was willing to pay for the item
Biology
Biomoleculesoperationalization of the depen What is a good variable in the following hypothesis Popular media increases liberal attitudes about sex How many hours of popular media do you watch a week How many dates should a couple go on before having sex with each other Do you like to watch cartoons answer options yes no 3 How much do you like popular media 1 not at all 7 very much
Biology
BiomoleculesWhat is xylem a plant cell type that carries out most the metabolic functions of the plant vascular plant tissue mainly consisting of tubular dead cells responsible for conducting water and minerals throughout the plant body a plant cell type that supports the plant body particularly in young plants and which is flexible so as to not restrain future growth vascular plant tissue consisting of living cells that transport sugar and other organic nutrients throughout the plant body a rigid supportive plant cell type which possesses thick secondary walls
Biology
BiomoleculesThe Spanish flu outbreak which lasted from 1918 1919 was one of the most severe pandemics in recent history it is believed to have infected over 500 million and killed over 50 million people worldwide this is more than any other pandemic including COVID 19 This flu was caused by the H1N1 virus and was unusually deadly For the scientific community the outbreak of the Spanish Flu began a race to create a vaccine Vaccines prevent deadly and or dangerous diseases by working with the body s immune system to reduce the risk of infection and develop immunity against the disease One of the leading causes of death for patients infected with the flu was a pneumonia infection in their lungs Due to this a British scientist named Frederick Griffith decided to focus his work on creating a vaccine to prevent pneumonia infections Pneumonia is caused by the bacterium Streptococcus pneumoniae Streptococcus pneumoniae has two forms the S strain and the R strain The S or smooth strain is covered with an outer coat known as a capsule and is highly virulent meaning it is able to cause the disease The R or rough strain has a rough appearance because it lacks a capsule and is therefore nonvirulent meaning it does not cause the disease Griffith was interested in researching ways to manipulate or change the S strain bacteria to alter its virulence Specifically he wanted to heat kill the cells to determine if that would reduce their virulence He planned to inject healthy mice with both the S and R strains What is a possible hypothesis for Frederick Griffith s experiment
Biology
BiomoleculesmRNA amino acids Met Ala Tyr Glu Lev val 2 DNA TACCTGTTAAGCTACAAAATT mRNALAUGEACAADUC GA GUUUGAA Mat A 3 DNA AATACGGG mRNAVU amino acids amino acids amino acids 4 DNA GCTAGTACGTGCACATTAGAA mRNA CGAUCAUGCACGUGUA AUC T A N A A U Valine Arginine c acid Alanine Asparti CGTAACCACTA MUGGUGAN UCAGU CA G GCA scid Agnar Glutamic QC AGU U CA GUCAGO CAGUAGU U Glycine G Phenyl alanine Leucine SU CA GU A C Serine CO Tyrosine UCAGUCA CU CA Stop Cysteine Stop Tryptophan Leucine
Biology
Biomolecules6 In a cross of AABBCC x aabbcc what proportion of the F generation are heterozygous 01 O O O 1 3 O 1 8
Biology
Biomolecules1 4 points Describe the following related to water a 1 pts Describe one thing that is special about the bonds between oxygen and hydrogen in a water molecule that makes hydrogen bonding possible b 3 pts Describe why hydrogen bonding in water important to life
Biology
BiomoleculesIn Chapter 3 we took a look at the biological macromolecules that make life possible This can be an exciting topic that gives students insights into topics such as nutrition and anatomy but it can also be a confusing topic for many students Look over the learning objectives for Chapter 3 and identify an objective topic that either gave you an Aha moment or left you confused even after listening to the lecture reading the materials and working through the homework For this week s discussion post I want you to describe either your Aha moment or muddiest point and then respond to two other classmates You may find that other students inspire you or get you to think about a topic differently You also may find that you can help a classmate with a topic that gives them trouble I will be posting videos each week addressing topics that you identify as your mussiest point DIRECTIONS Compose an initial discussion board post by creating a new thread The initial post should be 200 250 words and should include screen shots or links to the sources claims you reference Be sure to fully address the prompt above Reply to the discussion post of at least two of your classmates Your reply should be at least 100 words and may involve constructive questions additional thoughts insights or further information
Biology
Biomoleculesexplain how synaptic transmission can be modified at the pre and post synaptic side
Biology
Biomoleculesdifferentiate between chemical and electrical synapses differentiate between different glial cell types and explain
Biology
BiomoleculesListen Acid fast bacteria will not be decolorized by a acid alcohol and will therefore retain the carbolfuchsin red dye True False
Biology
BiomoleculesWhich of the following is NOT an enumerated power O Power to make laws O Power to coin Money O Power to set up Banks O Power to raise an Army a Navy O Other
Biology
BiomoleculesWhich of the following is NOT an example of implied powers being used O The creation of national holidays O The creation of the Environmental Protection Agency EPA O The Draft during wartime O Food Stamps O Other
Biology
BiomoleculesBased on the GRAM STAIN virtual lab you completed which circle shown here would contain bacteria B contains bacteria A No answer text provided There are no bacteria present O A contains bacteria B
Biology
Biomolecules2 Streptococcus mutans is one of the bacteria responsible for dental plaque formation ar lacks an outer membrane outside its cell wall Structurally and morphologically how would they look under the microscope Illustrate the appearance
Biology
BiomoleculesOrganisms of the Kingdom Protista are mostly microscopic and multicellular True False
Biology
BiomoleculesWatch the video explaining how slime molds are being used to design entire cities Create a discussion post that describes another way slime molds could be used for engineering research healthcare or any other field of work Your original post must include the following 1 A thorough description of what the slime mold would be used for 2 An example of a situation in which your proposed use of slime molds may be beneficial 3 Briefly describe how you would test your idea to see if it would work 4 After completing your original post review posts from other students and reply to at least two other students Your reply should include comments on your classmates o Use of slime molds o How that use might benefit society in a way different than what they are describing and or at least one suggestion to improve or expand on their experiment
Biology
BiomoleculesOD H H B H H I A I H H C I H N C 0 6 L R H NICO R H HICIR O HICI N C C H N C C O 7 OH aming
Biology
BiomoleculesImagine this system is at equilibrium Adding HCI to it would cause which of the components to increase HA H A H and HA HA only OH only A only
Biology
Biomoleculesof the following shows the correct ionization state of an amino acid in solution at pH 7 0 OC H H H N C C H OA H H B H H I D H I IR HICIR 0 N C C C HIC H N C 0 I R N C C OH O O
Biology
BiomoleculesMany characteristics of water make life possible Which of the following is NOT one of the reasons why you may need to refer to the reading and or video assignments for this one Water is an L shaped molecule Water is polar Water is a good buffer Solid water is less dense than liquid water
Biology
BiomoleculesWhat is the equilibrium constant for the following equilibrium A B C A B C C A X B C A B O A X B C
Biology
BiomoleculesWhich amino acid has an R group that forms covalent disulfide bonds glycine cysteine O proline none of the above