The Living World Questions and Answers

The region originally called "Persia" is based in which modern country? A. Iran B. Lebanon C. Jordan D. Egypt

In Hinduism, what dictates a person's position in their next life? A. karma B. their current position C. their parents position D. prayer

The earliest electronic computers were created in what decade? A. 1920s B. 1940s C. 1960s D. 1980s

Suppose your blood level of caffeine is 16 mg/L at noon. You ingest no caffeine after that, but at 6 p.m. you take a drug that alters your metabolism of caffeine so that from then on, its half-life is just half its normal value. What will your caffeine level be at 3a.m.? 2 mg/L 1 mg/L 4 mg/L 8mg/L

Choose the BEST answer: Glycolysis is... The first stage of aerobic respiration The first stage of fermentation It is the splitting of sugar and takes place in the cytosol The first stage of anaerobic respiration All the options are correct

Spinal interneurons prevent muscle antagonists from interfering with an intended movement by ... initiating a stretch reflex initiating a crossed extensor reflex initiating a tendon reflex the process of reciprocal inhibition

Before the Spanish-American War, foreign policy of the U.S. was characterized by and after the war it was now seen as being Social Darwinism, Imperialistic Expansionism, Isolationist Expansionism, Isolationist Isolationism, Imperialistic .

You are following a written procedure in a laboratory manual. The procedure tells you to make 500 mL of a 1.5 gram per liter sugar solution. How many grams of sugar will you need to make this solution?

When considering dominant alleles, these alleles are most commonly explained by: O a sequence change that makes a poisonous protein 0 a sequence change that expresses a protein with redundant function 0 a sequence change that causes a loss-of-function mutation 0 a sequence change that causes a gain of function mutation

Sara and Mara are identical twin sisters. Their parents had them late in their marriage, and they have two older siblings. Their father was diagnosed with Huntington's disease, a dominant monogenic disorder, shortly after his 50th birthday. Their older siblings were also diagnosed with the disease late in life; their sister Tamara was 52 at the time of diagnosis and their brother Jack was 53 when he was diagnosed. Sara and Mara's mother never showed signs of the disease. Sara is turning 50 next year, and is very concerned about her chances of also having Huntington's disease. So she looked into her family records and found out that her father's mother had Huntington's disease but not his father. With her family information, Sara performed a Punnett square and found out she has a 50% chance of having Huntington's disease. Based on this information, what can you say about Sara and Mara's parents? Their mother's genotype is hh and their father's genotype is HH. Their mother's genotype is Hh and their father's genotype is hh. Their mother's genotype is HH and their father's genotype is Hh. Their mother's genotype is hh and their father's genotype is Hh. Their mother's genotype is Hh and their father's genotype is Hh.

In bacteria, cells reproduce by dividing themselves to produce two daughter cells. Which one of the following statements is TRUE? The parental cell goes through mitosis to give its chromosome to the two daughter cells. The parental cell goes through meiosis to give its chromosome to the two daughter cells. The DNA is replicated producing two identical copies of the linear chromosome. The bacterial chromosome is shared via conjugation. The DNA is replicated producing two identical copies of the circular chromosome.

Women make less testosterone than men. Women who are heterozygotes for the balding trait (b) are not bald as adults. Men who are heterozygotes are bald as adults. A non-balding heterozygous woman has a baby with a balding heterozygous balding man. What is the probability that their baby will be bald in its adulthood? The baby has 0% chance it will grow up to be bald if male The baby has 50% chance it will grow up to be bald if male The baby has 25% chance it will lose hair if female The baby has 0% chance it will grow up to be bald if female The baby has 25% chance it will grow up to be bald if male The baby has 75% chance it will lose hair if female

In Green-bellied snakes, G-green belly. g-brown belly. When a pure-breeding green-bellied snake is crossed to a pure-breeding brown-bellied snake, 100% of the F1 has green and brown stripes. This is an example of. Codominance Penetrance Over-dominance Complete dominance Incomplete dominance

Occasionally, Drosophila flies are born with curly wings. Several of these unusual curly wing flies are crossed to one another with the following result: 522 curly wings, 266 normal wings. The mutation that causes curly wings probably: is recessive and semi-lethal in the heterozygote state is dominant and semi-lethal in the homozygous state is recessive and semi-lethal in the homozygous state is dominant and semi-lethal in the heterozygote state

In goats: Twild coat, t = long coat; C-produces large milk quantities, c- produces small milk quantities. Pure-breeding goats with wild coats and producing small milk quantities are mated with pure-breeding goats having long coats and producing large milk quantities. The F1 are then bred to one another. Assuming these traits follow Mendelian Inheritance and are unlinked, how many phenotypes do you expect to see in the F2? 4 2 1 3 0

Sarah and Bob are high-school sweethearts who have been married for 30 years. Sarah, who is Type A blood, has two children with Bob - Mary with Type O blood and Tim with Type B blood. Mary and Tim decided to sequence their DNA through 23andMe (a DNA Sequencing Company). While Tim's blood type alleles are I^B and i, Mary found out she has the alleles I^A and I^B. Based on the DNA sequencing data, what should be Mary's blood phenotype? Type O Type A Type AB Type B

MAKING CONNECTIONS Hamilton also uses the example of Grecian republics to talk about relations with Spain and Britain. What is the similarity between the two?

The expression of a gene involved in making anthocyanin (purple) pigment in pea flowers is controlled by a transcriptional activator. A point mutation in the gene encoding this protein results in a non-functional transcriptional activator, generating a loss-of-function allele. However, a heterozygote plant still makes purple flowers. Which statement below is TRUE? The allele generated by the point mutation will be recessive to the wild-type allele. One wild-type copy is not enough. The mutant allele produces a blended trait. The allele generated by the point mutation will be dominant over the wild-type allele. You always need both alleles for a pea plant to have purple flowers.

In sheep, the formation of horns is a sex-influenced trait, where the horns (h) allele is dominant in males but recessive in females. Females must be homozygous to grow horns. A horned male ram was crossed to an un-horned female sheep, and produced a horned female. What is the genotype of both parents? O Both parents were heterozygous O Father was either heterozygous or homozygous for the horned allele and the mother was heterozygous O Both parents were either heterozygous or homozygous for the horned allele O Father was either heterozygous or homozygous for the horned allele and the mother was homozygous for the horned allele O Father was homozygous for the horned allele and the mother was either heterozygous or homozygous for the horned allele

In a mechanical lever system, concentric action of skeletal muscle is considered: Internal (effort) force External (resistance) force Internal (resistance) force Moment arm of resistance

In France, The Battle of Somme was the bloodiest battle during WWI. it killed or wounded over 1 million men and it was the first time in history that this piece of military equipment was used. a) Anti-aircraft missiles b) Tanks c) Rifles d) Submarine

Analyze the impact of the Little Ice Age in the seventeenth century.

What is the most important question to ask when analyzing homologies to determine common ancestry? Do they live in similar places? Are the structures similar? Do they have a similar function? Do they eat the same foods?

Explain: How do organisms obtain and use the matter and energy they need to live and grow? (Use Mealworm as a model organism to write response) Molecules movement How are atoms in molecules being rearranged into different molecules? What is happening to energy? Carbon movement Answer:

Which science process skill is used to make this statement: Somebody must have left the door open because the robber was able to enter the house. Experimenting Hypothesizing Observing Inferring

A patient with beta thalassemia major is developing an enlarged jaw because: a. They are secreting too much growth hormone b. The abnormal RBCs are infiltrating the tissue c. Abnormal WBCs are infiltrating the tissue d. Their bone marrow is being over-stimulated

The term obligate refers to _____. the ability to exist in a wide range of conditions existing in a very narrow niche using chemicals for energy production using light for energy production using oxygen for metabolism

What effect does studying with music have on student test scores? If... one student studies with music and one student studies without music then... because... music can be distracting to some students The student who listened to music will do worse on a test It depends on the student The student who listened to music won't show up to class Both students will do great

Which best describes the activities of the Ku Klux Klan during the 1920s? Successfully achieved control of both Congress and the Presidency. Assisted Marcus Garvey in transporting African Americans "Back to Africa." Were solely directed at prevented African Americans from voting in the South. Saw its membership peak as it became a well-established, nationwide organization.

Identify the INCORRECT statement regarding locomotion: We have 2 CPGs, one for flexion & one for extension as a complete set for each leg The swing phase starts only if the leg is not bearing weight, the hip is extended, and the opposite leg is in stance phase As the heel strikes the ground, the mechanoreceptors will feed sensory information from your foot before you start the swing phase again We have the stretch reflex, Golgi tendon reflex, as well as the extensor thrust reflex, and the output of these reflexes cannot be switched from flexion to extension

Skin cancer (Basal Cell Carcinoma) is caused by UV light striking the skin cells. The light can cause a mutation in the DNA of the basal cells. This mutation can happen in the gene called p53 which is a tumor suppressor gene. Normal DNA: TCAAGG CCCGAGAAATTGACCCATCCAGGTTT Mutated DNA: TCAAGG CCCGAG AAATGA CCC ATCCAG GTT a. What type of mutation was caused by the UV light? Please put an asterick above the mutated DNA where the mutation occurred b. What are 3 symptoms of Basal Cell Carcinoma? c. What did the mutation do to the shape of p53?

Three students are discussing the nature of science. Below are their positions. Erika: Scientific understanding can change; in fact, the results of a single experiment can change an accepted scientific theory. Selvin: Science is a fixed and rigid discipline. Once a hypothesis is supported, it cannot be re-tested. Miguel: Science is an iterative process. Scientific understanding may shift over time given new data and findings across different sources. Which student has accurately described the nature of science? Enter the one-word name with correct spelling and capitalization. Do not add any extra spaces or punctuation. Type answer here. Be careful with spelling.

a tumor is initiated when: Select one: a. it has grown large enough to detect on an X-ray b. its cells attract blood vessels to feed it. c. its cells begin to grow more rapidly than normal in the GO phase d. cells are exposed to something that causes genetic change in a proto-oncogene

Which of the following is NOT a way that Jews were punished through antisemitism? Expulsion Pogroms kidnapping their children Ghettoization

What was an important effect of the Hundred Years' War? England established permanent control over much of France. The Black Death spread from France to England. A greater reliance on new weapons reduced the importance of knights. England and France failed to benefit from the Renaissance culture.

What is the significance of the Magna Carta (The Great Charter)? It gave royal authority to the government. It gave John the power of interdict. It limited the power of the king. It established King John as an absolute ruler.

Which of the following best describes the Church during the Middle Ages? It provided strong moral leadership It grew weak and divided It offered great comfort to people during hard times It wielded little political power

What was a major cause of the Hundred Years' War? The burning at the stake of Joan of Arc for witchcraft in 1431 The claims of King Edward III on the throne of France The division of the French royal family in to the Bourbons and the Armagna's

What does this illustration show about a typical manor? There were many factories and coal mines. Secular values in society were stressed. It was economically self-sufficient due to agriculture and trade.

A bond is formed when an electron is transferred from a sodium atom to a chlorine atom. What happens to the sodium atom during this process? The mass of the atom increases. The atom becomes an isotope. The atomic number decreases. The atom becomes a positive ion.

Biological anthropologists are interested in how culture is learned from one generation to the next. the emergence of human politics. the impact of colonialism on different cultures. archival data on the history of various cultures. human evolution and contemporary human variation.

Industrialization is product of urbanization. True False

What was the chief goal of the Crusades? To force the Byzantines to become Catholics To improve trade among Europe, Asia, and Africa To spread Christianity throughout Europe, Asia, and Africa To recover Jerusalem and the Holy Land from the Muslim Turks

Which of the following sentences with a parenthetical expression is punctuated correctly? a) Nick, what time is football practice? O b) Nick what time, is football practice? O c) Nick; what time is football practice? O d) Nick: what time is football practice?

The river made a pleasant noise as it flowed through the rocks. The writer revised this sentence to include personification. Which revised sentence shows an example of personification? a) The river laughed as it danced over the pebbles. b) The river wound through the forest like a train. c) The river was a symphony. d) The river was as quiet as a mouse.

This biotechnology visualizes mRNA on a nitrocellulose membrane using nucleic acid hybridization Eastern blotting Southern blotting Western blotting Northern blotting Central blotting

A pillory is a device used to imprison a person's head and hands, once used for public punishment. Read this quotation from paragraph 5 of the passage. "I got absolutely pilloried," says James. "I was on Today (a morning TV show) accused of killing the novel..." Which type of figurative language does the speaker use in this quotation? a) hyperbole b) idiom c) simile d) cliché

If subjected to sound frequencies of 25,000 to 100,000 cycles per second, which of the following would be least affected? A. a porpoise B. a house cat C. a cheetah D. a bat E. a human being

Cathie remembers feeling exceptionally exhausted and irritable every January. After years of struggling with this "winter depression," Cathie went to talk to a physician about her health concerns. She was diagnosed as having Seasonal Affective Disorder, or SAD. Millions of Americans are also affected by this disease, which causes anxiety, fatigue, and food cravings. SAD is associated with lower intensity and abbreviated periods of sunshine. The dark, gloomy hours of winter along with the shortened days cause this disorder to be the most severe from November through March. People who suffer from Seasonal Affective Disorder claim to find relief with exercise and bright-light therapies. Based on the passage, where in the United States would a physician encounter the most cases of SAD? A. southern Florida B. northern Minnesota C. eastern Virginia D. western lowa E. southwestern Arizona

Which statement best describes how potassium bonds with bromine? Potassium will donate an electron to bromine. Bromine will donate an electron to potassium. Bromine will donate seven electrons to potassium. Potassium will share seven electrons with bromine.