7 What mRNA base sequence is the complementary daughter strand to the following DNA informational parent strand Write the

Question

7 What mRNA base sequence is the complementary daughter strand to the following DNA informational parent strand Write the sequence of amino acids 5 AAUGAUAGGCCUCCGGCAUGA 3

Kunduz · Accepted Answer

Click to see the answer