Question:

9. Find the restriction sites and "cut" the DNA in the

Last updated: 7/30/2022

9. Find the restriction sites and "cut" the DNA in the

9. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would you see on the electrophoresis gel? BamI (CCT'AGG) --- 5' CCTAG ¥G 3'; EcoRI (GAATTC) --- 5' GAATTC 3' 3' 5' ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3'TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5'