Question:
9. Find the restriction sites and "cut" the DNA in the
Last updated: 7/30/2022
9. Find the restriction sites and "cut" the DNA in the sequence below. How many bands of DNA would you see on the electrophoresis gel? BamI (CCT'AGG) --- 5' CCTAG ¥G 3'; EcoRI (GAATTC) --- 5' GAATTC 3' 3' 5' ACGAATTCAGTATTATCCTAGGTATCCGCCGCCGAATTCTCATCA 3'TGCTTAAGTCATAATAGGATCCATAGGCGGCGGCTTAAGAGTAGT 5'