Question:

ion Practice Complete the lines below by determining the

Last updated: 3/16/2023

ion Practice Complete the lines below by determining the

ion Practice Complete the lines below by determining the mRNA transcript and amino acid sequence Compare the mutant DNA strands to the wild type strand Circle the mutation in the mutant DNA strands and describe the type of mutation frameshift in point missense point silent or point nonsense Not all of these will be frameshift deletion this assignment Wild type DNA template mRNA transcript sequence Amino acid sequence 3 TACGCGTGCACGATGCAGTAGTACATC5 Mutation 1 DNA template 3 TACGCGTGCACGATCCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence Type of mutation Mutation 2 DNA template 3 TA CGCGTGCTCGATGCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence Type of mutation Mutation 3 DNA template 3 TA CGCGCTGCACGATGCAGTAGTACATC5 mRNA transcript sequence Amino acid sequence ype of mutation Mutation 4 DNA template 3 TACGCGTGCACGATGCAGTAATACATC5 RNA transcript sequence