Question:

Original DNA Strand TTACAAJAGACGGTAAACT Mutated DNA Strand

Last updated: 11/13/2023

Original DNA Strand TTACAAJAGACGGTAAACT Mutated DNA Strand

Original DNA Strand TTACAAJAGACGGTAAACT Mutated DNA Strand mRNA Strand Amino Acid Sequence Specific Mutation Type 6 Red blood cells have a protein called hemoglobin that carries oxygen A mutation to the hemoglobin gene causes the disease sickle cell anemia Below is the portion of the hemoglobin gene where the mutation is found For each strand of DNA write the mRNA sequence circle the mRNA codons and write the amino acid sequence Normal hemoglobin DNA T ACCACCTGGACTGAGGACTCCTC mRNA Strand Amino Acid Sequence Mutated hemoglobin DNA resulting in sickle cell TACCACC TGGACTGAGGACAC CTC mRNA Strand Amino Acid Sequence What is the difference between the normal hemoglobin protein and the sickle cell hemoglobin protein What specific kind of mutation causes sickle cell anemia