Question 9 SARS D The same region in the genome of virus

Last updated: 12/4/2023

Question 9 SARS D The same region in the genome of virus isolated from a young otherwise healthy patient who exhibited particularly severe symptoms read 5 AAUUACCGUAUAGAUUGUUU 3 What is the mutant protein sequence select all possible answers H3N NYRIDCL coo H3N FLRYLYN coo H3N NYLYRLF coo O H N NY YRLF coo H3N NYRIDCF coo H3N NYRYRLF coo