SARS B SARS CoV2 is the causative agent of COVID 19 Like all

Last updated: 12/4/2023

SARS B SARS CoV2 is the causative agent of COVID 19 Like all coronaviruses it has a positive sense single stranded RNA genome The original Wuhan isolate of SARS CoV2 RNA sequence of the spike protein includes the following segment 5 AAUUACCUGUAUAGAUUGUUU 3 What is the protein sequence encoded here The protein region encoded by this segment is at the top of the receptor binding domain of the spike protein and is shown as a yellow circle in the figure in Question SARS A H3N IDK coo H3N NYLYRLF coo H3N FLRYLYN coo