Question:

SARS C The Delta Variant of SARS COV2 sequence of the same

Last updated: 12/4/2023

SARS C The Delta Variant of SARS COV2 sequence of the same

SARS C The Delta Variant of SARS COV2 sequence of the same region is 5 AAUUACCGGUAUAGAUUGUUU 3 What is the mutant protein sequence O H3N NYLYRLF coo H3N NYRYRLF coo H3N ID NTKN W coo H3N FLRYRYN coo H N NY YRLF coo H3N FLRYLYN coo H N FVLYVH coo