Biology Questions

The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.
Keynesian Economics does NOT argue that O Big Government national treasury and the Big Bank central bank have prevented reoccurrence of a crisis like the Great Depression after WWII a capitalist economy is fundamentally stable and prone to full employment it is the unstable and volatile investment that primarily causes fluctuation in an economy higher minimum wage and generous welfare programs can lead to strong economic growth through their support on aggregate demand
Biology
Ecology - Ecosystems
Keynesian Economics does NOT argue that O Big Government national treasury and the Big Bank central bank have prevented reoccurrence of a crisis like the Great Depression after WWII a capitalist economy is fundamentally stable and prone to full employment it is the unstable and volatile investment that primarily causes fluctuation in an economy higher minimum wage and generous welfare programs can lead to strong economic growth through their support on aggregate demand
What is NOT a reason for the Great Depression 1929 1941 World War II the Stock Market Crash of 1929 bank runs and failures attempts by the government to balance its budget
Biology
Ecology - Environmental Issues
What is NOT a reason for the Great Depression 1929 1941 World War II the Stock Market Crash of 1929 bank runs and failures attempts by the government to balance its budget
The economy is currently going through high unemployment Which fiscal policy recommendation will help return the economy to the full employment decrease the money supply decrease government spending increase interest rates decrease personal income taxes
Biology
Biotechnology & its Applications
The economy is currently going through high unemployment Which fiscal policy recommendation will help return the economy to the full employment decrease the money supply decrease government spending increase interest rates decrease personal income taxes
The annual inflation rate measures the percentage growth rate of the CPI from the base period 1982 1984 to a given year real GDP from the base period 1982 1984 to a given year real GDP from one year to the next the CPI from one year to the next
Biology
Cell Cycle and Cell Division
The annual inflation rate measures the percentage growth rate of the CPI from the base period 1982 1984 to a given year real GDP from the base period 1982 1984 to a given year real GDP from one year to the next the CPI from one year to the next
Which of the followings does NOT describe Universal Basin Income it would be less inflationary than Job Guarantee Program it is paid without any qualification tests or a requirement to work it is cash payment at regular intervals and recipients can use the cash for any purposes it would allow recipients to pursue what they want to do without worrying about their survival
Biology
Biological Classification
Which of the followings does NOT describe Universal Basin Income it would be less inflationary than Job Guarantee Program it is paid without any qualification tests or a requirement to work it is cash payment at regular intervals and recipients can use the cash for any purposes it would allow recipients to pursue what they want to do without worrying about their survival
What would happen to the neoclassical labor market if workers were less motivated to work due to generous government welfare programs labor supply curve shifts to the right thus decreasing the wage labor supply curve shifts to the left thus increasing the wage labor demand curve shifts to the left thus decreasing the wage labor demand curve shifts to the right thus increasing the wage
Biology
Cell Cycle and Cell Division
What would happen to the neoclassical labor market if workers were less motivated to work due to generous government welfare programs labor supply curve shifts to the right thus decreasing the wage labor supply curve shifts to the left thus increasing the wage labor demand curve shifts to the left thus decreasing the wage labor demand curve shifts to the right thus increasing the wage
What is NOT the correct statement about AD AS model too much expansionary fiscal policy can lead to demand pull inflation cost push inflation results from the AS curve shifting left Ofiscal policy is very effective policy but in reality there are timing issues fiscal and monetary policy works through aggregate supply curve
Biology
Ecology - Biodiversity & Conservation
What is NOT the correct statement about AD AS model too much expansionary fiscal policy can lead to demand pull inflation cost push inflation results from the AS curve shifting left Ofiscal policy is very effective policy but in reality there are timing issues fiscal and monetary policy works through aggregate supply curve
Which of the following events would most likely reduce aggregate demand a negative pessimistic consumer expectation a reduction in business and personal tax rates an increase in expected profits on investment a reduction in the amount of existing capital stock
Biology
Biological Classification
Which of the following events would most likely reduce aggregate demand a negative pessimistic consumer expectation a reduction in business and personal tax rates an increase in expected profits on investment a reduction in the amount of existing capital stock
A housing market crash dramatically reduces the amount of wealth in the economy In the short run it will reduce the real output and have no effect on the price level the price level and have no effect on the real output both the real output and the price level the price level and increase the real output
Biology
Biomolecules
A housing market crash dramatically reduces the amount of wealth in the economy In the short run it will reduce the real output and have no effect on the price level the price level and have no effect on the real output both the real output and the price level the price level and increase the real output
If there is a decrease in interest rates the long run result is an increase in the price level only an increase in real GDP and the price level no change in real GDP and the price level an increase in the price level and no change in real GDP
Biology
Biological Classification
If there is a decrease in interest rates the long run result is an increase in the price level only an increase in real GDP and the price level no change in real GDP and the price level an increase in the price level and no change in real GDP
What are determined in AD AS model Oreal GDP and nominal GDP the price level CPI and aggregate demand the price level CPI and aggregate supply real GDP and the price level CPI
Biology
Biotechnology: Principles and Processes
What are determined in AD AS model Oreal GDP and nominal GDP the price level CPI and aggregate demand the price level CPI and aggregate supply real GDP and the price level CPI
If the national incomes of our trading partners increase then our aggregate demand increases because net exports increase increases because consumption increases decreases because net exports decrease decreases because consumption decreases
Biology
Biotechnology: Principles and Processes
If the national incomes of our trading partners increase then our aggregate demand increases because net exports increase increases because consumption increases decreases because net exports decrease decreases because consumption decreases
There will be unemployment in a labor market if there are perfectly flexible wages there is no minimum wage the current wage is above the equilibrium wage the current wage is below the equilibrium wage
Biology
Biological Classification
There will be unemployment in a labor market if there are perfectly flexible wages there is no minimum wage the current wage is above the equilibrium wage the current wage is below the equilibrium wage
What is the cyclical unemployment George used to work in an automotive assembly plant He was laid off six months ago as the recession took place Kara voluntarily quit her job as an insurance agent to return to school full time to earn an MBA degree With degree in hand she is now searching for a position in management Sarah moved to a new place and is currently looking for a job Sam used to be a truck driver He permanently lost his job when his company replaced him with driverless vehicles
Biology
Cell Cycle and Cell Division
What is the cyclical unemployment George used to work in an automotive assembly plant He was laid off six months ago as the recession took place Kara voluntarily quit her job as an insurance agent to return to school full time to earn an MBA degree With degree in hand she is now searching for a position in management Sarah moved to a new place and is currently looking for a job Sam used to be a truck driver He permanently lost his job when his company replaced him with driverless vehicles
During a recession both the equilibrium wage and the equilibrium level of employment are low Why Olower supply of workers higher demand for workers lower demand for workers higher supply of workers
Biology
The Living World
During a recession both the equilibrium wage and the equilibrium level of employment are low Why Olower supply of workers higher demand for workers lower demand for workers higher supply of workers
Opportunity cost is the combined value of all the alternatives not selected based on the intrinsic value of the good itself the value of the next best alternative which was given up the same thing as the money price of a good
Biology
Ecology - General
Opportunity cost is the combined value of all the alternatives not selected based on the intrinsic value of the good itself the value of the next best alternative which was given up the same thing as the money price of a good
An increase in investment and government purchases can be expected to shift the aggregate demand curve to the left lead to movement up along the aggregate demand curve Olead to movement down along the aggregate demand curve shift the aggregate demand curve to the right
Biology
Biological Classification
An increase in investment and government purchases can be expected to shift the aggregate demand curve to the left lead to movement up along the aggregate demand curve Olead to movement down along the aggregate demand curve shift the aggregate demand curve to the right
Suppose the economy is experiencing deflation with very high unemployment when the target inflation is near 2 Which policy would the Fed central bank enact contractionary monetary policy by decreasing interest rates expansionary monetary policy by increasing interest rates contractionary monetary policy by increasing interest rates expansionary monetary policy by decreasing interest rates
Biology
Molecular Basis of Inheritance
Suppose the economy is experiencing deflation with very high unemployment when the target inflation is near 2 Which policy would the Fed central bank enact contractionary monetary policy by decreasing interest rates expansionary monetary policy by increasing interest rates contractionary monetary policy by increasing interest rates expansionary monetary policy by decreasing interest rates
H T H C OHA 1 6 0 CH 2 Ethanol 2 NAD 2 NADH 2 H Alcohol fermentation used by animal cells Ethanol fermentation generates ethanol 2 Pyruvic acid 2 CO H T CO is lost C O CH 2 Acetaldehyde Both Answer Bank 2 NAD C O H C OHA CH 2 Lactate 2 NADH regenerates NAD that can be used in glycolysis 2 H 2 Pyruvic acid Lactic acid fermentation No loss of CO Lactic acid fermentation used by yeast cells
Biology
Biotechnology: Principles and Processes
H T H C OHA 1 6 0 CH 2 Ethanol 2 NAD 2 NADH 2 H Alcohol fermentation used by animal cells Ethanol fermentation generates ethanol 2 Pyruvic acid 2 CO H T CO is lost C O CH 2 Acetaldehyde Both Answer Bank 2 NAD C O H C OHA CH 2 Lactate 2 NADH regenerates NAD that can be used in glycolysis 2 H 2 Pyruvic acid Lactic acid fermentation No loss of CO Lactic acid fermentation used by yeast cells
Cellular respiration is carried out in the presence of oxygen aerobic conditions or the absence of oxygen anaerobic conditions Determine whether each event occurs under aerobic conditions anaerobic conditions or both aerobic and anaerobic conditions Aerobic conditions fermentation glycolysis Anaerobic conditions electron transport chain Answer Bank citric acid cyme Krebs cycle Both
Biology
Biotechnology: Principles and Processes
Cellular respiration is carried out in the presence of oxygen aerobic conditions or the absence of oxygen anaerobic conditions Determine whether each event occurs under aerobic conditions anaerobic conditions or both aerobic and anaerobic conditions Aerobic conditions fermentation glycolysis Anaerobic conditions electron transport chain Answer Bank citric acid cyme Krebs cycle Both
Supercoil www Answer Bank protein chromatin DNA molecule chromosome
Biology
Molecular Basis of Inheritance
Supercoil www Answer Bank protein chromatin DNA molecule chromosome
Homologous chromosomes linked by a centromere have different parental origins Answer Bank Sister chromatids result of chromosome duplication may have different alleles
Biology
Biological Classification
Homologous chromosomes linked by a centromere have different parental origins Answer Bank Sister chromatids result of chromosome duplication may have different alleles
Identify the cell cycle stage for each cell in the diagram Vy V K Answer Bank metaphase prophase interphase telophase anaphase
Biology
The Living World
Identify the cell cycle stage for each cell in the diagram Vy V K Answer Bank metaphase prophase interphase telophase anaphase
Learning What are the functions of mitotic cell division replacement of cells asexual reproduction growth of multicellular organisms production of eggs or sperm
Biology
Biological Classification
Learning What are the functions of mitotic cell division replacement of cells asexual reproduction growth of multicellular organisms production of eggs or sperm
Match each cell with its stage in the cell cycle Telophase and cytokinesis Anaphase Interphase Prophase Metaphase Answer Bank
Biology
Cell: The Unit of Life
Match each cell with its stage in the cell cycle Telophase and cytokinesis Anaphase Interphase Prophase Metaphase Answer Bank
Label each phase of the cell cycle with the appropriate name or description phase of quiescence O S phase Answer Bank mitosis and cytokinesis U 14 last stage of interphase G phase
Biology
Cell Cycle and Cell Division
Label each phase of the cell cycle with the appropriate name or description phase of quiescence O S phase Answer Bank mitosis and cytokinesis U 14 last stage of interphase G phase
Identify each stage of M phase AAAA V V V V DOS Answer Bank VVK 3 8
Biology
The Living World
Identify each stage of M phase AAAA V V V V DOS Answer Bank VVK 3 8
The cell cycle is a repeating sequence of events that leads to the duplication and division of a cell Place the stages of the cell cycle in the order of their occurrence from the earliest stage of cell growth through the latest stage of cell division Earliest
Biology
The Living World
The cell cycle is a repeating sequence of events that leads to the duplication and division of a cell Place the stages of the cell cycle in the order of their occurrence from the earliest stage of cell growth through the latest stage of cell division Earliest
Arrange the amino acids coded for in the translation portion of the interactive in the correct order starting with the first amino acid at the top Start
Biology
Molecular Basis of Inheritance
Arrange the amino acids coded for in the translation portion of the interactive in the correct order starting with the first amino acid at the top Start
Complete the transcription of the RNA sequence using the DNA template DNA template ATC GAC De
Biology
Molecular Basis of Inheritance
Complete the transcription of the RNA sequence using the DNA template DNA template ATC GAC De
Macmillan Learn Transcription Answer Bank Translation
Biology
Biological Classification
Macmillan Learn Transcription Answer Bank Translation
Match each cellular component to a role in transcription or translation in eukaryotic cells protein complex that makes RNA polymers corresponding to a DNA template location where transcription occurs region of DNA that recruits the transcriptional machinery carries an amino acid to ribosomes and binds to mRNA an organelle where proteins are constructed RNA polymerase 15 Answer Bank promoter tRNA nucleus ribosome
Biology
Molecular Basis of Inheritance
Match each cellular component to a role in transcription or translation in eukaryotic cells protein complex that makes RNA polymers corresponding to a DNA template location where transcription occurs region of DNA that recruits the transcriptional machinery carries an amino acid to ribosomes and binds to mRNA an organelle where proteins are constructed RNA polymerase 15 Answer Bank promoter tRNA nucleus ribosome
The codon table identifies the amino acid sequence be translated from a human mRNA sequence This chart can also be used to identify amino acid sequences for other organisms Select all of the organisms that use the codon assignments shown in the codon table Staphylococcus aureus white shark oak tree lizard cat First Position U Phenylalanine Serine U Phenylalanine Serine Leucine Serine Leucine Serine C A G Leucine Leucine Leucine Leucine Isoleucine Isoleucine Isoleucine Methionine Valine Valine Valine Valine Proline Proline Proline Proline Threonine Threonine Threonine Threonine Alanine Alanine Alanine Alanine A Tyrosine Tyrosine Stop Stop Histidine Histidine Glutamine Glutamine Asparagine Asparagine Lysine Lysine Aspartic acid Aspartic acid Glutamic acid Glutamic acid G Cysteine Cysteine Stop Tryptophan Arginine Arginine Arginine Arginine Serine Serine Arginine Arginine Glycine Glycine Glycine Glycine
Biology
Ecology - Ecosystems
The codon table identifies the amino acid sequence be translated from a human mRNA sequence This chart can also be used to identify amino acid sequences for other organisms Select all of the organisms that use the codon assignments shown in the codon table Staphylococcus aureus white shark oak tree lizard cat First Position U Phenylalanine Serine U Phenylalanine Serine Leucine Serine Leucine Serine C A G Leucine Leucine Leucine Leucine Isoleucine Isoleucine Isoleucine Methionine Valine Valine Valine Valine Proline Proline Proline Proline Threonine Threonine Threonine Threonine Alanine Alanine Alanine Alanine A Tyrosine Tyrosine Stop Stop Histidine Histidine Glutamine Glutamine Asparagine Asparagine Lysine Lysine Aspartic acid Aspartic acid Glutamic acid Glutamic acid G Cysteine Cysteine Stop Tryptophan Arginine Arginine Arginine Arginine Serine Serine Arginine Arginine Glycine Glycine Glycine Glycine
ch amino acid in a protein is encoded by a group of three nucleotides known as a codon Use the codon table to match mRNA lons and the resulting amino acid sequence mRNA sequence amino acid sequence AUG pro UGC phe leu
Biology
Biological Classification
ch amino acid in a protein is encoded by a group of three nucleotides known as a codon Use the codon table to match mRNA lons and the resulting amino acid sequence mRNA sequence amino acid sequence AUG pro UGC phe leu
What is a conclusion that can be made based off of the data shown in the graph PERCENTAGES OF CODING DNA FOUND IN VARIOUS ORGANISMS Human Homo sapiens 2 Fruit fly Drosophila melanogaster 19 Round worm Caenorhabditis elegans 25 Arabidopsis Arabidopsis thaliana 28 E coli Escherichia coli 90 Percentage of DNA that codes for proteins Humans have fewer genes that code for proteins than other organisms Round worms and Arabidopsis have roughly the same number of coding DNA molecules The most complex organism shown is E coli whereas humans are the least complex A smaller percentage of fruit fly DNA codes for proteins than Arabidopsis DNA
Biology
Ecology - Environmental Issues
What is a conclusion that can be made based off of the data shown in the graph PERCENTAGES OF CODING DNA FOUND IN VARIOUS ORGANISMS Human Homo sapiens 2 Fruit fly Drosophila melanogaster 19 Round worm Caenorhabditis elegans 25 Arabidopsis Arabidopsis thaliana 28 E coli Escherichia coli 90 Percentage of DNA that codes for proteins Humans have fewer genes that code for proteins than other organisms Round worms and Arabidopsis have roughly the same number of coding DNA molecules The most complex organism shown is E coli whereas humans are the least complex A smaller percentage of fruit fly DNA codes for proteins than Arabidopsis DNA
1 Describe the purpose and goal of the Indian Removal Act 4 points
Biology
Biomolecules
1 Describe the purpose and goal of the Indian Removal Act 4 points
4 Transgenic Bt crops have been genetically modified to resist common herbicides have increased protein content produce an insecticide be tolerant of salt in the soil grow faster a b C d e
Biology
Biotechnology & its Applications
4 Transgenic Bt crops have been genetically modified to resist common herbicides have increased protein content produce an insecticide be tolerant of salt in the soil grow faster a b C d e
1 Before biopharming technology became available human proteins used in treatment of diseases were a b C d cadavers unavailable synthesized chemically free of contaminating factors harvested from slaughterhouses donated human blood or
Biology
Biomolecules
1 Before biopharming technology became available human proteins used in treatment of diseases were a b C d cadavers unavailable synthesized chemically free of contaminating factors harvested from slaughterhouses donated human blood or
The proofreading function of genomic DNA polymerase must be a function as the nucleotide addition function of DNA polymerase The enzymatic Time left 0 53 33 function of proofreading is Select one O a O b O C 5 3 exonuclease activity 5 3 endonuclease activity More than one of the above O d 3 5 endonuclease activity Oe 3 5 exonuclease activity
Biology
Molecular Basis of Inheritance
The proofreading function of genomic DNA polymerase must be a function as the nucleotide addition function of DNA polymerase The enzymatic Time left 0 53 33 function of proofreading is Select one O a O b O C 5 3 exonuclease activity 5 3 endonuclease activity More than one of the above O d 3 5 endonuclease activity Oe 3 5 exonuclease activity
Which of the following are important in reducing the errors in DNA replication in eukaryotic organisms Select one O a proofreading activity of genomic DNA polymerase O b More than one of these is correct O c nucleotide excision repair O d mismatch repair
Biology
Molecular Basis of Inheritance
Which of the following are important in reducing the errors in DNA replication in eukaryotic organisms Select one O a proofreading activity of genomic DNA polymerase O b More than one of these is correct O c nucleotide excision repair O d mismatch repair
1 What is the name of the DNA polymerase in the method 1 pt 2 What is the scientific name of the bacterium that produces the enzyme Use proper nomenclature 1 pt 3 What does denaturation in this process accomplish Explain 2 pts 35 5 denaturation at 95 C 3 5 annealing Primer 1 at 50 C extension at 72 C Cycle 1 double stranded DNA 2 copies of DNA Primer 2 53 5 3 DNA polymerase Primer 1 Cycle 2 DNA polymerase Primer 2 DNA polymerase Cycle 3 Cycle 4
Biology
Biotechnology & its Applications
1 What is the name of the DNA polymerase in the method 1 pt 2 What is the scientific name of the bacterium that produces the enzyme Use proper nomenclature 1 pt 3 What does denaturation in this process accomplish Explain 2 pts 35 5 denaturation at 95 C 3 5 annealing Primer 1 at 50 C extension at 72 C Cycle 1 double stranded DNA 2 copies of DNA Primer 2 53 5 3 DNA polymerase Primer 1 Cycle 2 DNA polymerase Primer 2 DNA polymerase Cycle 3 Cycle 4
5 Select four cards to create a food chain starting with a producer Label the trophic level of each organism in your food chain as follows producer primary consumer secondary consumer tertiary consumer Record your food chain in the space below using species names and arrows
Biology
The Living World
5 Select four cards to create a food chain starting with a producer Label the trophic level of each organism in your food chain as follows producer primary consumer secondary consumer tertiary consumer Record your food chain in the space below using species names and arrows
Can you write a takehome message about what you learned about career service
Biology
Ecology - General
Can you write a takehome message about what you learned about career service
Can you write a takehome message about what you learned about career service
Biology
Biological Classification
Can you write a takehome message about what you learned about career service
Can you write a takehome message about career service
Biology
Biomolecules
Can you write a takehome message about career service
Can you write a takehome message about career service
Biology
Biotechnology & its Applications
Can you write a takehome message about career service
Can you write a takehome message about career service
Biology
Biotechnology & its Applications
Can you write a takehome message about career service
Which choice best describes data from the table that support the team s conclusion Choose 1 answer B Adenine and xanthine were detected in both of the meteorite samples and in the soil sample Isoguanine and hypoxanthine were detected in the Murchison meteorite sample 1 but not in sample 2 Isoguanine and purine were detected in both meteorite samples but not in the soil sample Hypoxanthine and purine were detected in both the Murchison meteorite sample 2 and in the soil sample
Biology
Ecology - General
Which choice best describes data from the table that support the team s conclusion Choose 1 answer B Adenine and xanthine were detected in both of the meteorite samples and in the soil sample Isoguanine and hypoxanthine were detected in the Murchison meteorite sample 1 but not in sample 2 Isoguanine and purine were detected in both meteorite samples but not in the soil sample Hypoxanthine and purine were detected in both the Murchison meteorite sample 2 and in the soil sample
RNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are initiation elongation and termination 2 Look at the strands from DNA question number 4 Copy and paste the DNA strand that will be used as the template for Transcription Keep in mind the direction in which DNA is transcribed 2pts Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA 3 Template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 3 Transcribe your template strand into an RNA strand with correct base pairing and directionality 6pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts Original RNA strand 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3 After removing 30introns 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 3 Join the exons 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 Adding a Poly A tail 5 AUCGUACGAUCGUAGCAUCGAUCGUAGCAUCGUACAUAAAAAA 3
Biology
Biological Classification
RNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are initiation elongation and termination 2 Look at the strands from DNA question number 4 Copy and paste the DNA strand that will be used as the template for Transcription Keep in mind the direction in which DNA is transcribed 2pts Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA 3 Template 3 TAGCATGCTAGCATCGTAGCATGCTAGCATCGTAGCATGCTAGCATGTA 5 3 Transcribe your template strand into an RNA strand with correct base pairing and directionality 6pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts Original RNA strand 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3 After removing 30introns 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 3 Join the exons 5 AUCGUACGAUCGUAGCAUCGUACGUAGCAUCGUACAU 3 Adding a Poly A tail 5 AUCGUACGAUCGUAGCAUCGAUCGUAGCAUCGUACAUAAAAAA 3
Predict percentage of offspring with flower colors in snapdragons In snapdragons there is one allele that produces red flowers and another allele that produces white flowers Neither allele is dominant and heterozygous individuals have pink flowers A plant breeder decides to cross a red flowered snapdragon with a pink flowered snapdragon What percentage of the offspring do you expect will have red flowers Enter the number only without the percent sign For example enter 100 as 100 and enter 12 5 as 12 5 Numeric Response
Biology
The Living World
Predict percentage of offspring with flower colors in snapdragons In snapdragons there is one allele that produces red flowers and another allele that produces white flowers Neither allele is dominant and heterozygous individuals have pink flowers A plant breeder decides to cross a red flowered snapdragon with a pink flowered snapdragon What percentage of the offspring do you expect will have red flowers Enter the number only without the percent sign For example enter 100 as 100 and enter 12 5 as 12 5 Numeric Response