Biology Questions

Based on research which of the following sociological factors would most likely be associated with a Republican voter He is in a low income bracket O He is He is young O He is Protestant O He lives in a Northeastern city

How does a a person s sense of political efficacy affect his or her voting behavior One might vote because he she O believes the vote will make an impact A person may not vote because O he she feels an individual vote doesn t matter One might vote because he she believes the vote will make an O impact Also a person may not vote because he she feels an individual vote doesn t matter

As late as 1995 Congress passed what is known as the Motor Voter Law which has all of these provisions except allowing citizens to register to O vote while applying for a driver s license providing voter registration by mail allowing voters to vote over the internet making registration forms available at local offices of state employment welfare and other social service agencies

The Framers of the Constitution originally left voter rights and suffrage up to O the president O the Congress the Supreme Court O the states

What did the Voting Rights Act of 1965 address It outlawed voting practices O being used to disenfranchise African Americans It changed the minimum voting age from 18 to 21 It added Washington D C to the presidential electorate It eliminated paying a tax as a condition for voting

Which of these is NOT a qualification for the right to vote in the United States O Citizenship O Age O Residence O Party affiliation

What is the main cause for the lack of voting O O Disenfranchisement Religious beliefs O Lack of interest O Poor weather conditions

In lake Tanganyaka there is a population of fishes with 2 alleles B and b for the gene coding for the color of the dorsal fin of the fish B is dominant over b The dominant phenotype for the dorsal fin is black whereas the recessive phenotype is blue Following the Hardy Weinberg equation and knowing that the population includes 100 members 25 fishes with a blue fin 75 with a black fin including 20 of heterozygous determine the provide the value of p and that of q p 0 65 and q 0 35 p 0 35 and q 0 65 p 0 25 and q 0 75 p 0 122 and q 0 422 p 0 55 and q 0 25 p 0 422 and q 0 122

Why do some people believe the Senate is undemocratic Some people people believe that on O representation based population is undemocratic Some people believe that equal representation is undemocratic Some people believe that the House should have more power Na

Choose the correct answer The size of the U S House of Representatives changes every 10 years depends on the Census stays permanently at 435 members stays at 100 members 2 for every state

How does a special session differ from a regular session of Congress The public initiates special sessions Special sessions involve citizens in debate The president calls special to deal with O sessions emergencies There is no difference between the two Regular sessions and Ospecial sessions are different names for Congressional

6 Use the chemical formula of sucrose C 2H22O11 and aspartame C 4H 8N O5 to calculate their molecular weights Molecular Weight of Sucrose g mol

Armed with knowledge of what makes bacterial cells unique think about how you would design an effective antibiotic Answer the following two questions within a few sentences What part of the bacteria you would want to target and why AKA What would be an effective way to kill the bacteria 4 points How it will be selective for bacteria over human cells 4 points

2 Which of the following is NOT one of the facts used to conclude common descent Optional Answers 1 fossils 2 species distributions 3 genetics 4 direct observation

What is one of the partial causes for descent with modification Optional Answers 1 genetic drift 2 genetic mutations 3 common ancestry 4 sexual selection

A diploid set of homologous chromosomes where 2n 6 in Meiosis A Draw Prophase of Meiosis I prior to crossing over label homologous chromosomes a chromosomal tetrad and note where the alleles are that you marked Q How many chromosomal tetrads does this D Draw Anaphase I and Telophase I Q a What happens to the alleles of the gene loci you marked at this stage b Which of Mendel s Laws does this explain c What are the genotypes of the resulting daughter cells d How many different results can you possibly get e Which of Mendel s Laws does this explain

The mini pedigree below illustrates a pair of expectant parents One of them is heterozygous for a dominant allele causing a fully penetrant autosomal trait filled square The other is unaffected and lacks the dominant allele open circle The unborn child of this couple is represented by the diamond the child s phenotype is not yet known A SNP locus 10 map units from the gene determining this trait has 3 alleles A G and C the genotype of each individual for this SNP is shown below their pedigree symbol If the G allele of the SNP locus is on the same chromosome as the dominant trait allele in the affected parent what is the probability that the child will eventually express the trait AG O 100 O 0 O 90 O 10 AC CC

Use the following mRNA codon key as needed to GCC Alanine AAU Asparagine CCU Proline GGA Glycine UGG Tryptophan UGA Stop no amino acid GAA Glutamic acid GAG Glutamic acid AGG Arginine CCC Proline CAU Histidine The following DNA sequence coding strand occurs near the middle of the coding region of a gene DNA 50 mRNA 55 50 5 AATGAATGGGAGCCTGAAGGAG 3 The corresponding mRNA sequence is shown below Note that the coding strand of DNA has the same sequence as the mRNA except that there are U s in the mRNA where there are T s in the DNA The first triplet of nucleotides AAU underlined is in frame for coding and encodes Asparagine as the codon table above indicates OA G at position 50 60 55 OC A at position 58 65 OG A at position 53 swer this 60 5 AAUGAAUGGGAGCCUGAAGGAG 3 65 Which of the following DNA mutations is almost certain to result in a shorter than normal protein

Two different genes are located on the same chromosome in rabbits A particular female rabbit is heterozygous for alleles of both genes with alleles arranged as shown in the diagram to the right Scientists know that the two genes are on the same chromosome but do not know their exact relative positions as indicated by the dashed line Suppose this female mates with a male rabbit in which the same chromosome pair looks like this r Tr e tie Which of the following statements best describes the likelihood that this pair of rabbits would have offspring with a chromosome pair that looks like this R T E i e RTH 11 e tie O More likely if the two genes are very close together on the chromosome O More likely if the two genes are not very close together on the chromosome O Not likely because the R and e alleles are not on the same chromosome in either parent O Very likely because the random assortment of chromosomes during cell division to make sperm or eggs allows for the mixing of all alleles

Sue s chromosome 18 pair looks like this Bob s chromosome 18 pair looks like this Bob and Sue have a stillborn son with three copies of chromosome 18 that look like this In which parent did non disjunction occur You need additional information to determine which parent Bob A O Sue A

Calculate the molecular mass M W of the following Include units for full credit CO Given atomic masses C 12 O 16

Solve the concentration problem Show your work as best you can for partial credit Round to the nearest hundredth How many grams g of NaCl are required to prepare 30 mL of a 20 solution Given atomic masses Na 23 CI 35 5

Convert to scientific notation 0 038 Write your answer in the form of x 10 to show an exponent due to formatting in Canva

A Interaction between cells and extracellular environment

Mitochondrial Eve O Segment 2 3 O Segment 1 Segment 3 O Segment 4 4 This is a simplified version of the phylogenetic tree of humanity discussed in Video 5 4 based on analysis of mitochondrial DNA sequences Use this information to answer this and the next question Question 13 Non African clade 2 E and S Asian and other lineages African clade 1 Yoruba and other lineages If a new mutation occurs and becomes fixed within one or more clades in this tree in which numbered horizontal line segment would the mutation need to occur to be shared by all non Africans Africans in Clade 1 but not any of the other African clades African clade 2 Effik and other lineages African clade 3 Ibo and other lineages African clade 4 Mbuti and other lineages in which of the following could the mutation described in the previous question have occurred O The common ancestor of humans and chimpanzees who lived 7 million years ago A common ancestor of humans and Neanderthals who lived 500K years ago O Mitochondrial Eve who lived in Africa 200K years ago O The progeny of a mating between a Neanderthal and a human outside of Africa occurring 50K years ago 3 pts

Complete the sentences on elements and atoms using the words provided Carbon 12 Carbon 13 McGraw Hill 6 Protons 6 Neutrons 6 Electrons Click to select compounds daltons 2 The atomic mass of carbon 13 is electrons elements 1 The atomic number of carbon 13 i 3 If different atoms have the same r 4 Substances composed of atoms t 5 Atoms that have gained or lost ele ions isotopes molecules neutrons nineteen protons seven 6 Protons 7 Neutrons 6 Electrons Carbon 14 6 Protons 8 Neutrons 6 Electrons s but different numbers of neutrons they are called Click to select ame number of protons are called Click to select io longer electically neutral are called Click to select

8 8 1 A neutral oxygen atom atomic number 8 has 8 electrons located in 2 different electron orbitals True 2 Hydrogen has only one neutron and no protons in its nucleus False 8 3 An atom consists of a central nucleus surrounded by electrons that are in constant motion True 4 Almost all of the mass of an atom is concentrated in its electrons False 8 5 The orbital of an electron is the volume of space where the electron is most likely to be found True 6 Almost all of the volume of an atom is empty space True 8 7 The reactivity or chemical behavior of an atom depends primarily on the number of neutrons it has Click to select B 8 Modern physics indicates that we cannot determine the exact location of a particular electron at any given time Click to select 9 Electrons are maintained in their orbitals by their attraction to the positively charged nucleus Click to select B 10 Atomic orbitals represent probability distributions for electrons and come in a variety of shapes Click to select

Indicate whether each of the following statements about atomic structure is true or false Hydrogen 1 Proton 1 Electron Oxygen 8 Protons 8 Neutrons 8 Electrons LA neutral oxygen atom atomic number 8 has 8 electrons located in 2 different electron orbitals Click to select B phone neutron and no protons in its nucleus Click to select B

Choose the correct answer are among the most commonly adapted forms of writing O Plays O Movies O TV shows NI

8 In The Taming of the Shrew Bianca s suitor works as her Latin tutor In 10 Things I Hate About You he tutors her in Q O French O Greek O Spanish O Old English

Irony occurs we when words are used in a O manner equal to their intended meaning when obscure language is used when words are used in a different from their Omanner different intended meaning when familiar language is used

Hypothesis testing The formulation of a hypothesis is based on observations and refined by available information from past observations or research Place the following statements in the appropriate sequence showing the progression from an observation to a testable hypothesis Rank the options below Does temperature affect the growth of mold or is the difference in mold growth related to differences between the bread and the rolls You propose that colder temperatures impede the growth of mold You notice that the bread you left on the counter has more mold on it than do the rolls that you left in the refrigerator Bread placed in warmer temperatures should develop mold faster and more extensively than bread placed in colder temperatures No answer 234

For each statement below indicate whether it is True or False 1 Breaking the hydrogen bond between two water molecules is called dissociation Click to select B 2 When water dissociates an oxygen atom separates from the rest of the molecule Click to select 3 The hydroxide ion has an overall charge of 1 Click to select 4 A hydrogen ion is the same as a proton Click to select 5 When a hydrogen ion separates from a water molecule it usually combines with another water molecule to form a hydroniu ion Click to select 6 A hydronium ion has the formula H O Click to select 7 In pure water at 25 C about 10 of the water molecules are dissociated at any given time Click to select 8 In pure water the concentration of hydrogen ions always equals the concentration of hydroxide ions Click to select 9 In pure water the concentration of hydrogen ions is 1 x 107 molar Click to select 10 Water dissociates into oppositely charged ions Click to select

ndicate whether each of the following statements about covalent bonds 8 8 Bohr Model 8p 8n 8 io 8 1 A water molecule is held together by two single polar covalent bonds Click to select 2 Because oxygen has a greater electronegativity than hydrogen water molecules are polar with two partial negative charges near the oxygen atom and one partial positive charge near each hydrogen atom Click to select 3 Atoms differ in their affinity for neutrons a property called electronegativity Click to select B 4 In general electronegativity increases from left to right across each row of the periodic table and also increases down each column Click to select 5 In a nonpolar covalent bond there is an equal sharing of electrons between two atoms while polar covalent bonds involve an unequal sharing of electrons Click to select 6 A single molecule of oxygen O is held together by two double nonpolar covalent bonds Click to select 7 A covalent bond is formed when two atoms share one or more pairs of electrons Click to select 8 Polar molecules are electrically neutral but the distribution of charge within the molecule is not uniform Click to select 9 Although C and H differ slightly in electronegativity this small difference is negligible and C H bonds are considered polar Click to select B 10 Of the 4 most common elements found in living organisms nitrogen has the highest electronegativity and therefore the greatest affinity for electrons Click to select B

What is Swift s proposal in A Modest Proposal Killing and eating Irish children to solve problems of poverty Killing and eating English children to solve problems of poverty Selling Irish children to work as laborers in England Selling English children to work as laborers in Ireland

In Jonathan Swift s A Modest Proposal we understand that he is sympathetic to critical of children adults and sympathetic to the English and critical of the Irish sympathetic to children and critical of adults sympathetic to the Irish and critical of the English

of types of sarcasm I Brooding III Informative O I and II O II and III O I and IV Affect IV P

Satire is not intended to be taken literally O is intended to be taken literally is only accessible to a privileged few can only be written about governments

What is the goal of satire beyond entertainment O To warn or enlighten O To provoke emotion To create misunderstandings for the sake of humor To understand there is no goal beyond entertainment

Choose the correct answer You could reasonably guess that the most obvious form of sarcasm is self deprecating sarcasm O polite sarcasm O deadpan sarcasm

Reactivity of elements Indicate whether each of the following statements about the reactivity of elements is true or false 1 The eight element periodicity found in the Periodic Table is related to the number of electrons in the outermost energy level of the atoms that make up each element Click to select 2 Electrons in the first energy level of an atom are called valence electrons Click to select B 3 For atoms important to life if the first energy level is the outermost shell it is stable with 2 electrons If any other energy level is the outermost shell it is stable with 8 electrons Click to select 8 4 Atoms tend to react in ways that give each atom a stable outer shell of electrons Click to select 5 Atoms with an outer shell that is almost empty are located on the right side of the Periodic Table while atoms with an outer shell that is full or almost full are located on the left side of the Periodic Table Click to select 6 Atoms in the same row of the Periodic Table tend to have the same number of valence electrons Click to select B 7 Atoms with 7 valence electrons tend to be non reactive Click to select B

Choose the correct answer Sarcasm characterized by exaggeration and violent language is called O manic sarcasm O raging sarcasm O deadpan sarcasm

o detect It is expressed in a matter of fact tone OIt is expressed enthusiastically O It is expressed quietly O None of the choices

Creating hypotheses based on observations A hypothesis is a general principle or explanation that is derived from observations Suppose you make the following observations You look at 10 human liver cells and observe that each one has a nucleus You look at 10 onion cells and observe that each one has a nucleus You look at 10 nerve cells from a mouse and observe that each one has a nucleus a b C For each statement below mark True if it would be a valid hypothesis and mark False if it would not be a valid hypothesis 1 The onion cells I looked at have a nucleus Click to select B ing 2 All onion cells have a nucleus Click to select 3 All cells have a nucleus Click to select B Click to select B 4 Some cells have a nucleus 5 Only onion cells have a nucleus Click to select 6 Based on these three observations alone if I look at 10 skin cells from my hand would it be a reasonable hypothesis to conclude each one will have a nucleus Click to select

Democratic socialism is defined as a political system of elected representatives that act as the gatekeepers for shared ownership of property a political system common to western European nations where O the government imposes heavy taxes but pays for all essential services for the population a type of economic system in which voters choose socialism as their preferred method for obtaining goods and services a type of economic system in

Socialism is based on communal property ownership of communal ownership of labor O the laws of supply and demand O the laws of marginal return

What statement supports the definition of a command economy The government determines Owhat goods are produced how and for whom The government determines the quality of goods produced by imposing strict standards of production The marketplace determines O what goods are produced and for whom The marketplace determines O the quantity and quality of goods

What is the relationship entrepreneurship and between private ownership of the factors of production Entrepreneurs are willing to take risks to earn profits Private ownership of the factors of O production guarantees the entrepreneur will keep the profits or losses based on his her skills using the property Entrepreneurs are not willing to take risks to earn profits Private of property ownership guarantees the entrepreneur will keep the profits or losses Entrepreneurs are regulated by

Property rights are crucial in which of the following economies O Market capitalism Market capitalism and pure capitalism Market O capitalism economy capitalism pure and command Market command economy capitalism and

Which statement supports the definition of a market economy The market is determined by government intervention in the form of taxes and tariffs The marketplace determines what goods and services are O produced and for whom the goods and services are produced The marketplace is determined by the number of sellers of a particular good or service based on entrepreneurial skills The market determines the quantity and quality of goods