Biomolecules Questions and Answers

Biology
Biomoleculeslank luate fraction 1 luate fraction 2 luate fraction 3 Jash D E F G H 1 2 0 06 0 262 0 095 0 077 0 053 3 4 5 0 074 0 404 0 311 0 188 0 062 6 0 057 0 29 0 323 0 114 0 059 7 0 06 0 436 0 381 0 145 0 056 8 0 069 0 545 0 158 0 1 1 074 9 10 0 058 0 241 0 44 0 167 0 116 0 079 0 286 0 324 0 136 0 097 11 0 057 0 256 0 239 0 12 0 074 12 0 055 280 0 404 280 0 309 280 0 117 0 574 280 280

Biology
BiomoleculesN Normal n affected What are the chances of having an affected male 1 Point XN Xn 0 25 75 XN Y

Biology
Biomolecules11 REKID 13 OCTO Acts 19 7 14 THE 20 OUX 10 11 ME 15 a normal male a normal female a trisomy 21 male 21 a trisomy 21 female 22 16 700 17 46 X EXTER 12 18 Base Y

Biology
BiomoleculesMale Pattern Baldness is an X linked reces sive trait The shaded symbols on the pedigrees are bald Using the pedigree below what do you know about the parents of 6 1 Point 5 6 2 12 7 13 14 8 O Mom is bald dad is not bald 3 9 15 4 10 Mom is a carrier of baldness dad is bald Mom is a carrier of baldness dad is not bald 11

Biology
Biomoleculesinco fluidity regarding membrane Proteins are in a fixed position in the plasma membrane and display no motion The more unsaturated fatty acids found in the phospholipid bilayer the greater the membrane fluidity At low temperatures cholesterol increases membrane fluidity At high temperatures cholesterol increase membrane stability Cholesterol associates with the phosphate heads of the phospholipid bilayer


Biology
Biomolecules1 In what ways did Churchill contribute to the start of the Cold War 2 In what ways did Stalin contribute to the start of the Cold War did Truman contribute to the start of the Cold War

Biology
Biomolecules4 What do the political cartoons tell you about what these countries thought about each other during the Cold War 5 Based on everything you ve read and seen which country leader was mostly responsible for the origins of the Cold War Please explain using evidence


Biology
BiomoleculesHighlight the statements that describe pinocytosis and receptor mediated endocytosis Select at least 4 sentences to check your answer 1 Receptor mediated endocytosis uses the protein caveolin to coat the plasma membrane 2 Pinocytosis is known as cell drinking 3 Pinocytosis brings in small ions needed by the cell along with a droplet of fluid 4 The lack of receptors can prevent the uptake of materials needed by the cell and result in disease 5 Pinocytosis uses the protein clathrin to coat the vesicle needed to bring materials into the cell 6 Receptor mediated endocytosis targets specific molecules 7 A variation of pinocytosis is phagocytosis

Biology
BiomoleculesTerm Active transport Electrochemical gradient Pump Primary active transport Secondary active transport ATP Definition The charge difference across a selectively permeable membrane Movement of ions across a membrane which is directly fueled by cellular energy The cellular energy used to fuel active transport Proteins that drive the process of active transport Movement of a substance across a selectively permeable membrane from an area of low concentration to an area of high concentration with the use of cellular energy Movement of ions across a membrane that is not directly dependent on cellular energy

Biology
BiomoleculesSelect the statement s that is are related to passive transport Passive transport moves molecules from an area of high concentration to an area of low concentration with the use of energy A difference in the amount of a substance on either side of a cell is known as a concentration gradient Membranes that will allow any substance to cross the plasma membrane is known as selectively permeable Plasma membranes are amphiphilic

Biology
BiomoleculesDrag and drop the examples to their correct category of carrier proteins Uniporter Symporter Antiporter Calcium is removed from the cell while sodium enters the cell using an exchange protein Sodium potassium and chloride ions are transported by the loop of Henle and reabsorbed in the blood Calcium is actively transported into the sarcoplasmic reticulum of muscle cells Plants transport hydrogen ions and potassium ions into and out of root ca

Biology
BiomoleculesIF a person increases his or her activity level THEN here heart heat rate will increase due Ro the bealy cells increased need for oxygen BECAUSE

Biology
BiomoleculesDrag and drop the characteristics of macromolecules to their correct category Phospholipids Proteins Carbohydrates Proteins and Carbohydrates Phospholipids and Proteins Involved in the transport of materials in or out of the cell Function as enzymes Amphiphilic Forms a bilayer Involved in cell recognition Contains saturated or unsaturated fatty acids Component of glycoproteins and glycolipids The main component of the plasma membrane Found only on the extracellular surface of the plasma membrane

Biology
BiomoleculesUse the information you gathered from the previous page to complete the statement below You should use the open space before the box to come up with a rough draft of your statement IF a person increases his or her activity level THEN Olmakiong

Biology
BiomoleculesAccording to Professor Jewell President Abraham Lincoln decided to prosecute th Civil War for O Territorial reasons O Political reasons O Religious reasons

Biology
BiomoleculescDNA can be produced from mRNA The cDNA includes Introns and promoter region Exons and promoter region O Introns and exons O Exons only

Biology
BiomoleculesAll cells share the following features except All cells use proteins as catalysts O All cells translate RNA into protein the same way O All cells require ATP O All cells replicate their hereditary information by templated polymerization All cells are enclosed in a cell wall O All cells store their hereditary information in DNA

Biology
BiomoleculesAn glycolytic pathway is one that is both catabolic and anabolic energy producing enzymatic amphibolic redox reaction

Biology
BiomoleculesWhich coenzyme yields the most amount of energy when converted to ATP dur the ETC and chemiosmosis Acetyl COA NADH BGH FADH2


Biology
BiomoleculesU CI PROBLEM 8 Given the following DNA sequence CGAATCCGTATGCGTACAAGCTGCTATGO 1st 2nd 3rd 1 Assume the sequence is on the coding strand a Assume that the first reading frame was us corresponding polypeptide b Assume that the second reading frame was corresponding polypeptide was 11

Biology
Biomoleculesthis phylum The unicellular Paramecium is often used as a model ciliate Individual Paramecium cells exchange genetic material through conjugation a non reproductive sexual process After conjugation there are no daughter cells Only the two original cells are present Therefore it is not considered sexual reproduction The smaller micronuclei of the two cells are copied and swapped in the process A Paramecium that is undergoing conjugation may sometimes be confused with one that is going through fission asexual reproduction Paramecium Cytology 35 E Laurent Contractile vacuole Macronucleus Micronucleus Oral groove Pellicle Food vacuoles Mitochondrion Paramecium conjugation Anal pore Cilia Examine prepared slides of Paramecium or living cultures if available Paramecium conjugating and Paramecium undergoing fission For live cultures use a drop of Protoslo to slow the motion of the organism Draw and label the organism using the atlas as a guide Note the prominent nucleus and smaller structure micronucleus near the nucleus The indented portion represents the oral groove The cilia may appear as a faint fuzzy halo around the organism adjust the iris diaphragm and light intensity if necessary to view the cilia Describe the shape of the organism Paramecium Paramecium fission

Biology
Biomolecules10 pts Please respond to one of the below prompts A B or C You may respond to multiple prompts if you wish but only one response is required Multiple responses will not earn extra points beyond 10 pts 10 pts Comment on at least one of your peers responses with feedback The peer you respond to does not have to be on the same prompt you responded to for example if you respond to B for your first post you can comment on someone s post to prompt A or C Your comments could ask a question of the original poster give constructive feedback or respond to their comment If you disagree or wish to correct information posted by your peer please be sure to do so kindly Prompt A Columns 1 2 and 13 18 Groups 1A 8A of the periodic table all share an important trait The column tells you how many valence electrons an atom has In Group 1A Hydrogen Lithium and sodium all have 1 valence electron In group 2A Beryllium and magnesium have 2 valence electrons In group 3A Boron has 3 valence electrons In group 4A Carbon and Silicon have 4 valence electrons This means both Carbon and Silicon can make 4 covalent bonds Theorize why do we only see carbon based life If Silicon can make 4 bonds shouldn t it be able to make all the same structures Carbon does Research a little is Silicon based life likely to exist Prompt B The four macromolecules covered in chapter 5 not only make up the majority of our diet and make up our bodies We are what we eat after all What we choose to eat has a lot of factors going into it but it never hurts to be better informed Choose one of the macromolecules in the chapter and make a post about its affect on our diet For example proteins what are essential amino acids Can we get them from a plant based diet Or what is more calorie dense carbohydrates or fats Are trans fats still added to our foods or present in our foods What are hydrogenated oils Or you can choose your own prompt regarding the four macromolecules Prompt C In chapter 6 we learn about cells and all the components that make up a cell We only have time to touch on the basics of each organelle in this course but there s a lot more to each of them in fact cell biology is an entire semester long upper division course at 4 year universities and sometimes even multiple semesters For this prompt choose one of the organelles you find interesting and do some research on it Pubmed and Google Scholar are great places to find new cutting edge research Locate an article you find interesting about your chosen organelle link it here and provide a very short 1 2 line summary of the

Biology
Biomolecules4 What tool is used to predict the genetic outcome of offspring from parents Hint it s not 23 and me

Biology
BiomoleculesWhat was the significance of Hershey and Chase s findings THERE FOR V7 TEN OA They provided evidence that DNA carries heritable information OB They supported the idea that alleles are passed on independently of one another OC They introduced the concept of a transforming principle OD They showed that offspring inherit one allele for a trait from each parent showeve Home SOUTHER TIME WHATS Market T

Biology
BiomoleculesGenes store genetic information regarding which of the following A The number of DNA molecules that make up a chromosome OB The number of nucleotides needed to build a DNA molecule C The order of amino acids that make up specific proteins D The sequence of proteins used to organize chromosomes

Biology
BiomoleculesCarboxyl group QUESTION 9 What level of protein structure involves covalent and pleated sheats within a polypeptide chain


Biology
BiomoleculesQUESTION 2 Match the functional groups R Q H R G O R 910 C OH A Carboxyl B Amino C Methyl D Carbonyl E phosphate F Hydroxyl


Biology
BiomoleculesOH OH OH CH OH O Polysaccharide 0 Monosaccharide OH O OH OH OH How would you classify this molecule O Disaccharide

Biology
BiomoleculesOH How would you classify this molecule O O 02 OH Disaccharide 3 QUESTION 6 How many fatty acid chains could potentially be joined to glycerol maximum 01 Polysaccharide Monosaccharide

Biology
BiomoleculesWhat type of molecule is being depicted below HHHHHHHHH FELELTHET C C C C C C C C C C H TELELI 0 0 H C O H C 0 0 H C O 0 0 I HHHHHHH I O H H HHHHH EEELLE I C C C C C C C C C C H EEEEELT HHHHHHH HH EF C C C C C C C C C H HHH Saturated triglyceride Steroid Cholesterol Unsaturated triglyceride Phospholipid I 0 I O I H 1 H H

Biology
BiomoleculesGiven the following cladogram and list of characteristics Moss Fern Conifer Flowering Plant Chlorophyll a b Yes Vascular tissue No Seeds No Flowers No Moss Fern Yes Yes No No 2 Flowers 3 Seeds Conifer Yes Yes Yes No Based on what you know about the principle of parsimony which of the following is most likely a synapomorphy of conifers and flowering plants 1 Both chlorophylls a and b and seeds Flowering Plant Yes Yes Yes Yes


Biology
BiomoleculesIf a cell has a damaged organelle or has some inclusion which needs digestion it will merge with a the Golgi apparatus Acceptable Formats Give me options These are small organelles created by

Biology
Biomolecules3 The three arcs below represent part of the cell membran a Label the cell membrane and cytoplasm for each cell b Sketch and label the following structures if present on membrane periplasm LPS teichoic acid mycolic acid pori

Biology
BiomoleculesWhich of the following is NOT TRUE of dehydration synthesis O Larger molecules can be made from smaller subunits using dehydration synthesis O The breakdown of the sugar lactose into the smaller sugars glucose and galactose would be an example of dehydration synthesis O Many polymers are the product of dehydration synthesis The process of dehydration synthesis results in the removal of a water molecule QUESTION 4 Which of the following IS NOT a polymer Protein DNA K Phospholipid

Biology
BiomoleculesFarmers spray pesticides on their plants to protect the Some individual insects have a genetic mutation that the pesticides Which statement best describes how or resulted in the pesticide becoming ineffective The resistant insects change the toxin on the plants making it safe The resistant insects eat the contaminated surface and leave the res The resistant insects are able to survive to reproduce and create a p O The resistant insects grow larger and eat less of the plants

Biology
BiomoleculesPercentages of Nitrogenous Bases Organism A Human Chicken Rat E coli 73 2 O 28 4 O 26 6 29 4 G 28 0 29 3 20 7 20 0 28 4 21 4 C 26 9 21 6 25 7 Based on Chargaff s rule the percentage of cytosine of a rat in the figure above should be arou Seg n la regla de Chargaff el porcentaje de citosina de una rata en la figura anterior debe ser de alrededor T 30 0

Biology
BiomoleculesWhich of the following statements is FALSE Reducing agents like BME affect tertiary structure but not quaternary structure A change in protein primary structure may affect quaternary structure Increasing or decreasing pH does not affect primary structure Secondary structure is completely disrupted by treating a protein with urea

Biology
BiomoleculesWhich level of protein structure does or can involve covalent bonding tertiary O quaternary O primary All of the above None of the above 500

Biology
BiomoleculesWhich of the following levels of structure will be affected by boiling Select all that apply Answer any level that is directly affected by boiling even if some aspects of that level of structure may remain 000 Primary Secondary Tertiary Quaternary

Biology
BiomoleculesShown below is a randomly selected internal fragment of a polypeptide i e the ends are NOT SHOWN The polypeptide is the amino N terminus and new amino acids would be added to the end if it is still undergoing SH NH CH CH OH Left left Left right Right left Right right O NH CH CH C10 NH CH C NH CH3 CH end of this polymerization

Biology
BiomoleculesShown here is a monosaccharide HO CH C H H C HO Alpha Beta L H C C OH OH H TE anomer

Biology
BiomoleculesWhich arrow s in the polypeptide shown point to peptide bond s below A B C D R A B C D both A and D N 0 R R HN 0 R NH R

Biology
Biomoleculesand 1 blotting immunoblotting by placing the phrases to the technique that they describe If a phrase describes both ELISA and western blotting place it under Both ELISA Western blot with SDS PAGE Answer Bank Both

Biology
BiomoleculesWhich of the following statements accurately describe a chromosome Select the THREE 3 that apply Chromosomes contain more than one DNA molecule linked together and then tightly wound Chromosomes contain one long DNA molecule that is tightly wound Every chromosome has many genes and each gene is one segment of DNA Each chromosome has one gene as the entire segment of DNA which makes up a gene In any given organism the gene s found on one chromosome can also be found on other chromosomes There may be two different versions of the same gene on different chromosomes