Molecular Basis of Inheritance Questions and Answers

syndrome Directions Step 1 Make a TEMPLATE DNA Strand Step 2 Show the sequence of the mRNA from the TEMPLATE DNA using the mRNA base pairing rules Step 3 Name that process Where is that process takes place Step 4 Using the Genetic Code chart Codon chart based on the mRNA sequence write Amino Acids sequence Step 5 Name that process Where is that process takes place Step 6 Circle the mutation in the DNA Step 7 Circle altered Amino Acid DNA 5 Step 1 Template DNA 3 Step 2 mRNA 5 CAG Red Blood Step 3 Name the process Where does it take place DNA CCT Step 5 Name the process Where does it take place Step 4 Amino Acid wed likener bld appear like death Individual X Normal FIBRIN Protein CTA ATC GTC GGA TAGGAT CAG CCU ATC CUA GGG FL 2010 GGG Normal Microfibril GCC who Individual Y Mutated FIBRIN Protein Marfan syndrome CCT ATC CAG CTA GTC GGA TAG GAT ETC CAG CCU AUC CUA GAG EL KORE GAG Marfan Microfibril 18 Explain how the a change in one base caused the individual to have Marfan syndrome

Question 38 If one strand of a DNA molecule has the sequence ATTGCA the other strand would have the sequence O UAACGU O TUUCGU O TAACGT O TUUGCT O TAAGCT 1

Expression of NGN2 TH auced pluripotent cells causes the cells to have transcriptiona profiles that mark them as mainly glial cells Some cells similar to central nervous system neurons some cells similar to peripheral nervous system neurons cells similar to central nervous system neurons cells similar to peripheral

exons of a gene found in five different eukaryotic species Each part is numbered to indicate its distance from the promoter for example intron I is the one closest to the promoter The data reported for species A were obtained by comparing DNA from one member of species A to the DNA of another member of species A Sequence Homology Species Intron I Exon I Intron VI Exon V 100 100 100 100 98 99 82 99 89 A B C D E 98 99 98 99 Intron VI 92 99 80 96 96 97 94 Which of these four gene parts should allow the construction of the most accurate phylogenetic tree assurning this is the only part of the gene that has acted as a reliable molecular clock 3 points

p repressible operon q lac operon of E coli lacZ lacY lacA structural genes r Cap site lacP laco s Lac repressor Lacl t CAP u cAMP vs glucose v mutations affecting the lac operon lacZ lacl lack laco lacP w trp operon of E coli

Home 30 a During which stage of Translation does the mRNA molecule attach to the small ribosome subuni O Termination Ob Intation Oc Polyemization Od Bongation Energy cannot be created or destroyed but it can be changed from one form to another Os First Law of Thermodynamics Ob Second Law of Thermodynamics O Kinetic Energy Od Potential Energy

apiens uploM UN 5 Use the genetic code table Which amino acid is coded for by only one codon sequence a b C d e a b serine threonine isoleucine methionine valine C d eiori elqitiuM A noitet no inereista odl setelamos laad teri eoloro erit ylilneb 6 What happens in the process of transcription noboo hela art not sorsupee ebiloeloun orlt ei todW t DOA DAD Exons are excised to create the final mRNA sequence A poly A tail is added to the pre mRNA molecule A splicesome finishes the mRNA messenger RNA is assembled using a DNA template DUA DAU opa 10 10

M 12 Breaks hydrogen bands resulting in th formation of areplication fork during the process of DNA replication bi coronase TB RNA polymerase C Helicase D DNA polymcrose

Determining the exact sequence of a gene would be whether a trait is inherited in a dominant vs recessive pattern would be O Transmission Population O Molecular Population Physiological Transmission genetics whereas determining genetics

What do you notice about the orientation of the left strand compared to the right strand

Edit View Insert Format Tools Table 12pt P nonsense G sense aph v There are four possible results from a mutation missense BIU AT V

If a researcher is examining cells from a breast tumor biopsy which of the following microarray assay DNA chip outcomes would best support a diagnosis that the tumor is cancerous a group of cDNAs expression matches those in colon cancer samples from the same population O the expression pattern in these cells differs from the pattern in non tumor breast tissue O the pattern of fluorescence indicates some cells are undergoing mitosis O a mitochondrial encoded gene shows significantly higher expression in these cells than in liver cells

During the elongation phase of translation which site in the ribosome represents the first location where a codon pairs with an anticodon O the large ribosomal subunit OP site A site E site

5 If the following mutations would occur in the coding region of a gene which is the least likely to cause a structural or functional change in the protein that the gene encodes Answers A E A An insertion of 2 nucleotides B A nonsense mutation CA deletion of 4 nucleotides D A mutation at the third position of a codon F A mutation at the first position of a codon

Which of the following statements are true Mark any or all that apply In reverse genetics the DNA sequence of a gene is known before mutations in that gene are made Gene editing can begin with CAS9 nuclease introducing a double strand DNA break at a specific DNA sequence in a live cell Gene editing represents a form of forward genetics Homologous recombination will lead to integration of a transformed DNA fragment into random locations throughout a cell s genome Some animal species have been cloned by replacing an egg cell nucleus with the a nucleus from a somatic cell

Define the following a Gene expression b Constitutive expression c Positive regulation d Negative regulation e Regulatory element f Regulatory protein g DNA binding domain

0 00 0 00 A C B BB 6906 B B b b RTY Speed 1x the genes of every elephant in the world all of the genes of elephants within a breeding population

repressor i activator j allosteric protein k inducer 1 corepressor m operon n operator

Rosalind Franklin s x ray diffraction images taken in the 1950s most directly support which of the following claims about DNA I A The ratios of base pairs are constant B The nucleotide sequence determines genetic information C The two strands of DNA are antiparallel D The basic molecular structure is a helix

Home 41 p 42 hard Student Resou In a population of deer females are most attracted to males with the largest antlers so those ma frequently Over many generations the average male antler size increases This is an example of stabilizing selection O Ob artificial selection Oc directional selection Od bottleneck effect in Eukaryotic cells which biological molecule would not be formed if mRNA was trapped inside of the nucleus Da Upids Ob Glucose Oc Nucleic Acids Od Proteins

A reverse transcribing DNA virus in Baltimore group VII must first convert the dsDNA to of the dsDNA genome single stranded DNA double stranded DNA double stranded RNA single stranded RNA protein before using that to create copies

21 For E coli strains with the following lac genotypes and genotypes on the next page use a plus sign to indicate the synthesis of galactosidase and permease and a minus sign to indicate no synthesis of the proteins Genotype of strain lack lacP laco lacZ lacy lack lacP lacO lacZ lacy lacht lacP laco lacZ lacy lack lacP lacO lacZ lacy lack lack lac0 lor7 lev Lactose absent B Galactosidase Permease Lactose present B Galactosidase Permease

the DNA sequence below to answer the following questions vena horla 8 noiloo2 5 bns beylovni me 1 mark i ii iii 3 TACGAACGAGTGCCCCAAAATT polo What is the complementary DNA strand vilena s r What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand 1 mark Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence 2 marks

How does the data support the hypothesis that DNA not proteins is the ansforming principle

15 A mutation prevents the catabolite activator protein CAP from binding to the promoter in the lac operon What will the effect of this mutation be on the transcription of the operon

14 During DNA replication one of the new strands of DNA is synthesized continuously while the other is synthesized as a number of separate fragments of DNA that are subsequently linked by DNA ligase This is because replication starts at many points on the chromosome a RNA primers only anneal to one of the parental strands of DNA DNA polymerase III only synthesizes DNA in the 3 direction one of the parental strands is unwound slower than the other by helicase DNA polymerase III only synthesizes DNA in the 5 3 direction b C d e

9 RNA polymerase participates in DNA replication RNA replication DNA transcription a b C d RNA transcription e RNA translation

and to rok Goods an red of bus por any poporop Sy he go up by ssawed off b ST

Match the terms with their descriptions Antiparallel Complementary Replication Semi conservative Sequence Template Choose Choose The process of copying DNA This is the strand of DNA that is used as a guide to build the other strand Each copied DNA strand is made of 1 old strand and 1 new strand 2 strands of DNA match up due to base pairing The two DNA strands run in opposite directions 5 to 3 and 3 to 5 The order of the nucleotides along a strand of DNA codes the genetic information of the org Choose Choose Choose

7 What is the function of DNA polymerase in DNA replication a enhub C d e AU all of the above a b to create replication bubbles by unravelling the parental strands of DNA to insert new bases during elongation using the parent strand as a template C d to create an RNA primer to initiate DNA replication to anneal splice smaller fragments of DNA to create one continuous strand neup 8 What is the function of DNA ligase in DNA replication e stelgur ANG rli ei todW 8 JAD DO to create replication bubbles by unravelling the parental strands of DNA to insert new bases during elongation using the parent strand as a template to create an RNA primer to initiate DNA replication to anneal splice smaller fragments of DNA to create one continuous strand all of the above DAU AQU

What are some of the issues of genetic testing What is your opinion on how genetic information should be used Don t forget to expand the discussion with new information that has been referenced

SCENARIO 2 A new house still under construction is vandalized The builders would like to know who may have caused this property damage He hopes there may be fingerprints on a 2x4 piece of wood near the damaged part of the house Which chemical method would be the best to use and why

Exit Ticket 4 0 A 1 Below is a segment of DNA that is ready to be replicated Show the processes that the segment will go through during replication after 7 nucleotides have been added to both strands Make sure to include the names of the enzymes that are involved You may draw your response as one process or a series of processes ATGCCGTTATCAGGACTGC TACGGCAATAGTCCTGACG 2 Below is a segment of DNA that is ready to be replicated Show the processes that the segment will go through during replication after 6 nucleotides have been added to both strands Make sure to include the names of the enzymes that are involved You may draw your response as one process or a series of processes

2 You have sampled a population in which you know that the percentage of the homozygous recessive genotype aa is 36 Using that 36 calculate the following A The frequency of the aa genotype B The frequency of the a allele C The frequency of the A allele D The frequencies of the genotypes AA and Aa

Multicellular organisms have different cell types because of gene regulation Which statements are true depictions of how human gene regulation works Check All That Apply Genes transcribed only in lung cells are present only in lung cell nuclei and genes transcribed in eye cells are present only in eye cell nuclei etc Some genes are transcribed only in kidneys because their enhancers are present only in kidney cells The genes that encode proteins present in muscle cells but not brain cells must be transcribed in muscle cells but not brain cells If a gene is transcribed and that transcript is processed the same way and also translated in all cell types the protein the mRNA encodes must be present and active in all cell types The enhancers of all genes exist in all cell types The transcript of a gene can be spliced the same way in cells of the iris and cornea but the protein might be active only in the iris cells A gene can be transcribed in both eyes and skin but the mRNAs of that gene could encode different proteins in those two cell types a skin specific protein and an eye specific protein If a protein is present only in pancreas cells that means that the gene encoding that protein is transcribed only in the pancreas If a particular gene is transcribed only in your bones that means that the gene s enhancer is active only in bone cells

Determine whether each of the following mutations has severe effects mild effects or no effects at all a Nonconservative missense mutations not in the active site of a protein b Nonconservative missense mutations affecting the active site of a protein c Silent mutations d Conservative missense mutations e Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of a protein f Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of a protein g Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of a protein h Frameshift mutations occurring in the sequences encoding amino acids near the C terminus of a protein

12pt V Paragraph V BI 4 themes of gene expression Epigenetic Transcriptional IC

RNA molecule has three potential reading frames while a double stranded DNA molecule has six potential reading frames O True O False

The sequence of RNA processing changes a primary transcript synthesized by RNA polymerase into a mature mRNA These processing steps include i addition of a run of As a poly A tail near the 5 end of the primary RNA ii addition of a modified G nucleotide called a 5 cap to the 3 end of the RNA and iii RNA splicing the process by which introns are removed and degraded and exons are connected together True False

Degeneracy because a 1 amino acid 1 codon 1 tRNA relationship does not exist O True O False

Wobble describes how the anticodon of a single tRNA species can base pair with several different codons for the same amino acid O True O False

same region of a gene isolated from three independent mutants are given below Pink Mutant 5 ACCGTAATCGACTGGTAAACTTTGCGCG 3 Green Mutant 5 ACCGTAGTCGACCGGTAAACTTTGCGCG 3 Blue Mutant 5 ACCGTAGTCGACTGGTTAACTTTGCGCG 3

State four 4 themes of gene expression Edit View Insert Format Tools Table T A

4 When would an insertion or deletion mutation NOT result in a frameshift mutation Think of at least 2 different cases

6 What did the DNA look like Does this match your prediction

4 There is a special type of RNA called siRNA silencing RNA that can complementarily bind to an mRNA transcript and create a short double stranded segment of RNA This unnatural dsRNA is marked for destruction with the result being an interruption of the central dogma and pre translational removal of an RNA transcript In an experiment several genes 1 2 and 3 suspected of being transcription factors of Gene X were targeted using specific siRNA molecules The effect on the transcript levels of Gene X was measured by RT qPCR Transcript abundance after siRNA knockdown Transcript abundance 500 450 400 350 300 250 200 150 100 50 none 1 2 a Briefly describe the processes of transcription and translation and explain how they contribute to the flow of genetic information from genotype to phenotype b Explain how eliminating mRNA transcript for one 1 3 2 3 Downregulating siRNA Figure 1 Abundance of Gene X mRNA transcript after application of siRNA targeting Genes 1 2 or 3 in individually or in pairs c Protein 1 is added to a cell Predict the effect on the levels of Protein X d Justify your prediction using specific information from the experiment

Five COVID 19 mutants were identified that did not attach to epithelial cell membranes Complementation testing of the five 5 mutants was performed and yielded the following results 1 2 3 4 1 2 3 4 5 5 1 How many genes were identified by complementation testing Which COVID 19 mutants comprised each of the complementation groups

Peptidyl transferase within the ribosome forms covalent bonds between amino acids O True False

What is the biggest disadvantage of having a degenerate genetic code Mutations are more likely to alter the amino acid sequence of proteins causing deleterious consequences to the organism Mutations are less likely to alter the amino acid sequence of proteins It increases the number of different proteins that can be coded by each gene It increases the total number of tRNAs that have to be made

Which of the following is translated in the rough ER Glycogen phosphorylase Protein kinase A OG proteins Growth factors