Molecular Basis of Inheritance Questions and Answers

Four nucleic acid samples are analyzed to determine the percentages of the nucleotides they contain Which of the following DNA sample s could be double stranded DNA Sample 1 A 22 G 28 T 22 U 0 C 28 Sample 2 A 30 G 30 T 0 U 20 C 20 Sample 3 A 18 G 32 T 0 U 18 C 32 Sample 4 A 29 G 29 T 21 U 0 C 21 O Samples 1 and 2 O Sample 1 O Samples 1 and 4 Samples 2 and 3 O Samples 3 and 4

If DNA of a particular species was analyzed and it was found that it contains 27 percent of adenine A what would be the percentage of cytosine C 23 percent 27 percent 54 percent 30 percent

The experiments by Hershey and Chase helped confirm that DNA was the hereditary material on the basis of the finding that Radioactive phosphorus was found inside the cell Radioactive cells were found in the supernatant Radioactive sulfur was found inside the cell Radioactive phage were found in the pellet

The phenotype of an organism is the genetic information stored in the DNA O True O False

A gene is O a building block of RNA O segment of DNA coding for a specific protein an RNA molecule a building block of DNA

A parent that is RrPp can produce which gametes Rr RP Rp rP rp and Pp ORP and rp only Rr and Pp only RP Rp rP and rp

Which term describes the passing of traits from parents to offspring O polyploid non disjunction locus heredity

27 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCACACUAGUUGC 3 Translate this sequence What type of mutation is this I

0 21 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGGCCCGCACAAUAGUUGC 3 Translate this sequence What type of mutation is this

The following are needed for translation to occur EXCEPT Ribosomes transfer RNA messenger RNA RNA polymerase

DNA replication requires which of the following DNA polymerase and helicase RNA polymerase and helicase Ribosomes and RNA Transcription factors

Which of the following best depicts the flow of information of gene expression RNA DNA protein DNA RNA protein protein RNA DNA RNA DNA protein

Heterozygous Summarize how test crosses work by using the words genotype and phenotype to complete the sentence In a test cross the Homozygous of the parents Answer of the offspring can reveal the Homework Connections Selective breeding practices have been used since ancient times Provide specific examples where selective breeding has resulted in plants or animals that are familiar to us today

14 CSI Wildlife Explain how gel electrophoresis is an affective technique for identifying the source of samples of evidence a Explain the basic process of gel electrophoresis b How do you read a gel to determine paternity or where a sample came from

2 Lulu the lion use of DNA alleles to determine paternity a What type of data can be used to identify potential parents b What type of data can be used to confirm parents of offspring

D 75 E 100 hat is the name of the enzyme that catalyzes synth A Helicase B Single Stranded Binding Proteins SSBPs C Ligase D DNA Polymerase E Primase The relationship between a gene and a messenger RNA is that A genes are synthesized from an mRNA template B mRNAs are synthesized from gene template CmRNAs make proteins which then code for genes D all genes are made from mRNAs E none of the above are correct 10

DNA Replication Describe the semiconservative model of replication Describe the process of DNA replication Explain SDALA

Explain why researchers orginally thought protein was the genetic material Describe the structure of DNA Explain the base pairing rule and describe its significance

10 Describe the process of translation including initiation elongation and termination and explain which enzymes protein factors and energy sources are needed for each stage 11 Describe what determines whether a ribosome will be free in the cytosol or attached to the rough endoplasmic reticulum

Transcription and Translation

3 Compare where transcription and translation occur in prokaryotes and in eukaryotes 4 Define codon and explain the relationship between the linear sequence of codo

2 Briefly explain how information flows from gene to prote Commore where ription and translation occur in pro

As mentioned previously it is lucky that Mendel chose to study pea plants and even more lucky the specific characteristics of pea plants he examined If he were to study more plants or more characteristics he would have seen exceptions to his principles This is because as we know now each chromosome carries many genes with each gene at a particular locus If genes are located on different chromosomes like we saw in the previous example then they assort independently which is also exactly what Mendel saw But what happens to genes that are located on the same chromosome Well they may be inherited together if they are located near each other These genes are therefore known as linked genes 4 Refer back to the ratios of phenotypes of the offspring generated from the testcross in question 3 on the previous page How would these ratios change if the genes for seed texture and plant height were linked Why Using the same plant let s examine two new traits shape of pollen grains and number of leaves To determine whether these traits assort independently or are linked a cross is performed between a homozygous plant with round pollen grains and two leaves PPLL and a homozygous plant that has long pollen grains and one leaf ppll Examine the diagram below depicting the crosses and then fill in the chart with the expected number of offspring for each phenotype shown P Generation F Generation Testcross Offspring of Testcross PPLL PpLI Meiosis would produce 4 types of gametes Observed Expected PL 991 X PpL1 X Pl 350 ppll ppll PL 334 A plant that is homozygous dominant for both traits is crossed with a plant that is homozygous recessive for both traits The resulting offspring are all heterozygous for both traits One of these offspring is then used in the testcross An offspring from the F generation is then crossed with a plant that is homozygous recessive for both traits pl 1025 pl Meiosis would produce 1 type of gamete 2 700 Total Offspring

2 A group of researchers isolate Protein X from the wall of a human stomach with the intent of learning how to synthesize stomach tissue in the lab Subsequently they determine the exact sequence of amino acids of the protein in its unfolded state and create a functional mRNA template to translate Protein X in vitro They manage to translate an exact copy of the polypeptide chain in the lab but then realize that it takes several days for the protein to fold into its final tertiary structure In vivo they observe that several thousand copies of Protein X are folded from polypeptide chains every minute What is NOT a plausible explanation for this difference in folding times A The in vitro study lacks a key tRNA molecule B The pH in vitro is too high C The in vitro study lacks a key enzyme D The temperature in vitro is too low

1 In tigers a recessive allele causes a white tiger the absence of fur pigmentation If two phenotypically normal tigers that are heterozygous at this recessive gene are mated what proportion of their offspring are expected to be white A 1 2 B 3 4 C 2 3 D 1 16 E 1 4

E codominance 6 Male pattern baldness is a recessive sex linked trait on the X chromosome A woman whose father had male pattern baldness marries a man with this trait What is the probability that any son born will have pattern baldness SOUS F E

Suppose the economy is experiencing deflation with very high unemployment when the target inflation is near 2 Which policy would the Fed central bank enact contractionary monetary policy by decreasing interest rates expansionary monetary policy by increasing interest rates contractionary monetary policy by increasing interest rates expansionary monetary policy by decreasing interest rates

Supercoil www Answer Bank protein chromatin DNA molecule chromosome

Arrange the amino acids coded for in the translation portion of the interactive in the correct order starting with the first amino acid at the top Start

Complete the transcription of the RNA sequence using the DNA template DNA template ATC GAC De

Match each cellular component to a role in transcription or translation in eukaryotic cells protein complex that makes RNA polymers corresponding to a DNA template location where transcription occurs region of DNA that recruits the transcriptional machinery carries an amino acid to ribosomes and binds to mRNA an organelle where proteins are constructed RNA polymerase 15 Answer Bank promoter tRNA nucleus ribosome

The proofreading function of genomic DNA polymerase must be a function as the nucleotide addition function of DNA polymerase The enzymatic Time left 0 53 33 function of proofreading is Select one O a O b O C 5 3 exonuclease activity 5 3 endonuclease activity More than one of the above O d 3 5 endonuclease activity Oe 3 5 exonuclease activity

Which of the following are important in reducing the errors in DNA replication in eukaryotic organisms Select one O a proofreading activity of genomic DNA polymerase O b More than one of these is correct O c nucleotide excision repair O d mismatch repair

Mendel used the garden Olily carrot onion pea plant for his studies on inheritance QUESTION 48 In modern terminology Mendel s heredity factors are called O DNA O chromosomes O genes ORNA

QUESTION 49 Traits that are controlled by genes located on the X chromosome are said to be O autosomal O gametal O sex linked Opleiotropic QUESTION 50 The lagging strand is replicated with a series of Okazaki fragments and that is why its synthesis is considered to be O discontinuous O continuous O bidirectional O antiparallel Osemiconservative

Which base in an anticodon will pair with the base adenine in a codon O thymine O cytosine O guanine Ouracil QUESTION 34 A codon is composed of how many bases O one O two Othree O four GA

During translation amino acids are carried to the ribosome by O mRNA O tRNA O snRNA O rRNA O miRNA QUESTION 32 RNA polymerase synthesizes a molecule of RNA using DNA as a template During O mRNA splicing Otranslation O transcription O gene sequencing

Xeroderma pigmentosum XP is a rare autosomal recessive disorder Patients with XP exhibit a cellular hypersensitivity to ultraviolet UV radiation a high incidence of skin cancer and premature aging Based on these clinical characteristics what is the most likely cause for this disease defects in DNA repair defects in DNA replication lack of telomerase activity shortened telomeres QUESTION 22 If a mutation produced helicase that was unable to hydrolyze ATP DNA replication would be stopped speeded up unaffected more prone to errors

The site where the two original DNA strands separate and active replication occurs is called the O replication fork replisome primosome lagging strand sliding clamp subunit QUESTION 14 During replication which enzyme unwinds the DNA double helix O DNA primase O DNA polymerase I DNA helicase DNA gyrase O DNA ligase

QUESTION 5 Information obtained by Franklin from X ray crystallography on DNA suggested that it is shaped like a O helix O ribbon O hollow cylinder O pleated sheet O icosahedron QUESTION 6 In DNA complementary nitrogen bases are held together by bonds O hydrogen bonds O hydrophobic bonds O peptide bonds

Where along the parent DNA strand does synthesis of the new DNA strand take place Select one a O b Forks are used to pop the replication bubbles O d Outside of the replication bubbles OC At the forks of the replication bubbles Only in areas were the DNA is zipped up

chromosome Some useful information orf is the origin of replication strand A and strand B are referring to the template strands for replication to the right of the origin of replication you ll have to use your imagination to picture the soon to be replicated new strands ori strand A strand B For each question below select from the options in A through D and the explain A if the word or phrase is associated with strand A only B if the word or phrase is associated with strand B only Bio285 F23 C if the word or phrase is associated with strand A and B D if the word or phrase is associated with neither strand A nor B Topic 9 Problem Set 1 Replication of this strand involves a single primer molecule ii Replication of this strand involves several primer molecules 3 end 15 end ui Replication of this strand does not need primer Francis

E When the primer in the middle is removed and filled in with DNA the fragments mu then be joined i Which type of enzyme fills in the DNA after the primer has been removed Explain A DNA polymerase fills in the DNA after the primer has been removed

Which of the following does not affect the amount of a certain protein synthesized in prokaryotic cells Mark the correct answer s mRNA processing Use of alternative sigma factors binding of repressors to operator sequences Transcription regulation Stabilization of the mRNA Inhibition of translation with miRNAs

Match the following mutations with the correct designation of its type i e dominant or recessive N 2 1 d 69 S Is Choose Choose Choose recessive dominant ICH V

1 2 3 tus Signals beginning Signals end 4 5 6 7 8 9 10 11 12 11 Translation Transports amino acids 9 Complements codon 10 A Termination sequence B AUG C Ribosome D Template strand E mRNA F Coding strand G Anticodon H Polypeptide 1 Promoter J Codon K UGA UAA UAG Takes place 7 End product 8

Match the RNA function with the correct type of RNA Carries the message of DNA into the cytoplasm for ribosomal A rRNA processing B SRP RNA C snRNA D tRNA E Small RNA F mRNA Multiple types found in ribosomal subunits Carries amino acids to ribosomes to make proteins Processes pre mRNA Contains both protein and RNA found within RER Y Control of gene expression

Match the mutation with its most appropriate correct description If a portion of a chromosome is broken off and joined to another chromosome If a region of a chromosome is replicated within a chromosome When a portion of a chromosome is broken off then turned around and put back into the chromosome A nonsynonymous mutation that changes the required amino acid When a mutation changes a sequence of amino acids that are regular to a stop codon When the reading of bases is added to or reduced and changes the reading of correct amino acid sequences When a sequence of DNA is replicated three times found in Huntington s disease A Inversion B Translocation C Frameshift D Nonsense E Duplication F Triplet repeat expansion G Missense

1 What is the mode of inheritance in the pedigree chart above Dominant TO Recessive Codominance 80 166 I II III IV Carrier Incomplete dominance 2 What is the mode of inheritance in the pedigree chart above Carrier Sex Linked Incomplete Dominance KEY Does not have condition Has condition Carrier Multiple Alleles B Complete the following exercise 1 Make a concept map showing the different types of inheritance analyses

A researcher extracts the cytosol and cytoskeletal components from the cell and places the mixture into a tube What result do you expect if the researcher adds a nonhydrolyzable GTP analog to the mixture in vitro O overstabilization of all polymerized microtubules present in the tube destabilization of all polymerized microfilaments present in the tube overstabilization of all polymerized microfilaments present in the tube O destabilization of all polymerized microtubules present in the tube