The Living World Questions and Answers

Which of the following is true of fruits Select all that apply They are seed bearing They provide nutrition to the developing seeds They facilitate the dispersal of seeds All fruits have evolved to attract animals 4

Monoecious Black Walnut trees are a common tree in Central Pennsylvania their nuts are an important source of food for wildlife They flower in the spring This photo shows those flowers male and female lowers are found on the same tree Choose all of the terms below that apply to this plant Dioecious Synoecious Female flower Perfect flowers Male flower Imperfect flowers

Question 7 In seed plants the gametophyte plants 0 5 generation is more reduced than in seedless

What are the NACE competencies Give me your idea about them and how they work for you

What are the NACE competencies Give me your idea about them and how they work for you

Write a conclusion about emotional intelligence Clifton strengths and NACE competencies and what is the best selfrefection about them

glucose and lactose lactose glucose Question 27 ISP O Z Y A repressor can t bind allolactose glucose lactose alunnee Choose Choose Choose Choose Choose

Amino acid residues 1 through 13 of the spike protein constitute its signal peptide The signal peptide s sequence is H N MFVFLVLLPLVSS coo What is the overall nature of the signal peptide It s positively charged It s hydrophobic It s negatively charged O It s hydrophilic but uncharged

You have generated several random mutations in this region One of them is 5 AAUUACCUAUAGAUUGUUU 3 What may be the mutant protein sequence Enter the single letter code for the amino acids For a stop codon if any enter STOP And fill subsequent blanks with N A For example if you the sequence you need to enter is M enter M N A N A N A N A

SARS C The Delta Variant of SARS COV2 sequence of the same region is 5 AAUUACCGGUAUAGAUUGUUU 3 What is the mutant protein sequence O H3N NYLYRLF coo H3N NYRYRLF coo H3N ID NTKN W coo H3N FLRYRYN coo H N NY YRLF coo H3N FLRYLYN coo H N FVLYVH coo

SARS B SARS CoV2 is the causative agent of COVID 19 Like all coronaviruses it has a positive sense single stranded RNA genome The original Wuhan isolate of SARS CoV2 RNA sequence of the spike protein includes the following segment 5 AAUUACCUGUAUAGAUUGUUU 3 What is the protein sequence encoded here The protein region encoded by this segment is at the top of the receptor binding domain of the spike protein and is shown as a yellow circle in the figure in Question SARS A H3N IDK coo H3N NYLYRLF coo H3N FLRYLYN coo

glucose 6 phosphatase catalase Ophospholipase C Question 30 1 point Listen Saved Which of the following organelles produces and modifies polysaccharides that will be secreted by a eukaryotic cell O lysosome O mitochondrion peroxisome

polarizing repolarizing hyperpolarizing threshold Question 26 1 point Saved Listen Dynamic assembly and disassembly of a cytoplasmic microtubule in a cell occurs primarily at its plus end because its minus end is usually anchored to a mitochondrial outer membrane the plasma membrane a microtubule organizing center

Actin filaments may form each of the following except filament networks O contractile bundles Obranched networks central shaft of flo

glia the myelin sheath nodes of Ranvier synaptic boutons minate at structures called Question 41 1 point 1 Listen Each of the following is true about Ras except O Ras activity is inhibited by GTPase activating proteins GAPs Ras binds steroid hormones O Ras is monomeric coll

The technique that can be used to record ion currents passing through individual channels is known as ligand gating voltage gating patch clamping optogenetics

An example of a generally inhibitory neurotransmitter is GABA O glutamate O acetylcholine

Kinase enzymes always inhibit target molecule activity add phosphate groups O bind tightly by wrapping around a target molecule to regulate its activity remove phosphate groups

Each of the following is a type of glial cells except Platelets oligodendrocytes astrocytes von

Each of the following is an intracellular messenger except IP3 calcium ions O CAMP acetylcholine

The phase at the end of an action potential when the membrane potential becomes more negative than it is at rest is the phase depolarizing Orepolarizing

Compounds that inhibit receptors by preventing the natural messenger from binding are known as growth factors antagonists agonists arrestins

The parts of the graph indicated between points C and E represent Membrane potential 40mV 40mV 60mV Stimulus hyperpolarization depolarization repolarization sodium channel activity B 0 for 1 2 Time msec 73 4

Plasma membrane permeability of which of the following ions is most important in generating the resting membrane potential Chloride ions Calcium ions Potassium ions Ammonium lons

The variant of Apolipoprotein E ApoE associated with increased risk of Alzheimer s disease is O ApoE1 O ApoE2 O ApoE3 ApoE4

Memantine a drug used in management of Alzheimer s disease is antioxidant a cholinesterase Inhibitor an NMDA antagonist Serotonin reuptake inhibitor

oths have even appeared to orbit around them the streetiamps come on a lang row of them glowing uselessly along the ring of garden chat circles the city center where your steps count down the sailing of delight end stop At your feet a bee crawis in smail circles like a toy unwinding end stof simile Summer specializes in time slows it down almost to dream And the noisy day goes so quiet you can hear the bedraggled man who visits each trash receptacle fersonification mutter in disbelief Everything in the world is being thrown away end stop Summer lingers but it s about ending It s about how things redden and ripen and burst and come down It s when lend Stop city workers cut down trees demolishing one limb at a time spilling the crumbs end stop of twigs and leaves all over the tablecloth of street

The following chemical disinfectants can be used as food preservatives Mark all that apply Formaldehyde and ethylene oxide Acids sorbic benzoic propionic sulfure dioxide nitrites Nisin Natamycin Quaternary ammonium salts

ERY PEN OXA TECO OXA wat dit VAN ESPANNE SPT VAN Source KBTyoutube Phenol coefficients M PEN 31 ERY TEC VAN OXA O Microbial contamination in a disinfectant solution O Microbial growth on selective media O Antimicrobial susceptibility SPT VAN OO O PEN OXA ERY TECO OXA wat S VA

On the topic of microbial growth control match the terms in the two columns BSL 4 BSL 1 Antiseptics Disinfectants Choose Choose Dangerous microbes posing aerosol transmitted infections Process of applying an antiseptic Microbes are not known to cause disease in healthy hosts Microbial chemical inactivation on the surface of skin or tissue Microbial inactivation on the surface of a fomite by chemical heat

Instructions Watch the video The Crisis of Credit Visualized from this link https www youtube com watch v bx LWm6 6tA and explain what caused the 2007 8 Great Financial Crisis Also read the article The Global Financial Crisis in the AS AD Model and explain the following recession and the recovery with the AS AD Model Feel free to draw an AD AS Graph

https www youtube com watch v bx LWm6 6tA and explain what caused the 2007 8 Great Financial Crisis Also read the article The Global Financial Crisis in the AS AD Model and explain the following recession and the recovery with the AS AD Model Feel free to draw an AD AS Graph

The following is a picture of a black legged tick The bacterium Borrelia burgdorferi can be transmitted to humans through the arachnid s bite and cause Lyme disease What type of disease transmission is caused by this arthropod

We know that one large category of American commercials are those that try to convince you to choose particular medications For this Ulcers and Antacid assignment you are going to design a commercial for a made up antacid of your design and explain how your medication will alleviate symptoms and prevent the creation of ulcers For this you ll first need to research what these things are and what they do This should be IB quality work and scope Directions 1 Research what an ulcer is and how it is created 2 Research what symptoms ulcers cause and how they can be treated 3 Research what antacids are and how they work in general 4 Research how antacids can be used to treat ulcers 5 Design a fake antacid that you are going to be selling or convincing people to buy 6 Create a diagram that will help you explain and or carry out your commercial 7 Create a script for presentation

Identify different minutiae ridge patterns from the prints below Broken ridge ridge ending enclosure eye Delta Bifurcation Fork Island Highlight or circle and label

Connect the term to the action of the bacterial virulence factor Adhesins Exoenzymes DNAse Endotoxin Toxic shock syndrome toxin Choose Choose Produce by S aureus to break down a net of host s DNA that would keep the bacteria trapped Extracellular enzymes that break down intercellular matrix components of the host s adjacent cells Molecules on fimbriae and pili that attach to the surface of intestinal epithelial cell receptors Superantigen that stimulates excessive immune system activation LPS on OM of Gram negative bacteria triggers inflammatory response on the host Choose

According to the graph what is the number of virions that caused 60 out of 200 rats to die from the viral infection Percent mortality in experimental group 100 90 80 70 60 50 40 30 20 10 0 10 102 103 104 105 106 107 108 10 Number of pathogenic agents cells or virions 0 O 10 virions O 100 virions 1000 virions virions

We talked about 4 different types of movement that lipids within a membrane experienc a Draw a sketch that outlines these 4 different movements Scramblave Flix and alarease

We talked a couple weeks ago about red blood cells and their ability to carry oxygen but this week we discussed red blood cells and their interesting shape Why do red blood cells have such a unique shape How does this unique shape help red blood cells accomplish their goals

There is a lot of belief that this molecule you outlined in b has a much greater ability to carry oxygen than hemoglobin but we know shockingly little about this molecule Why do you think so little research has been done on this molecule What are some moral or social implications regarding how little this molecule has been studied

oteins flippase and floppase only work on organelle membranes that are inside the cell they o not work on the cell membrane However the cell membrane is still highly asymmetrical Please explain the process through which the cell membrane is able to be asymmetrical without the use of flippase and floppase Include sketches in your explanation a

on Completion Status Relives torque 33333333333 V S VB 10 V 11 Untwists strands 812 12 11 Holds open DNA strand g Attachment for enzyme 10 13 Continuous assembly 6 A RNA primer B Telomerase C DNA ligase Reads copies DNA 5 D Gyrase E Excision repair F DNA polymerase i G Mutation H Single stranded binding proteins L Photo repair Leading strand K Okazaki L Helicase M Lagging strand Discontinuous assembly Fragments 8 40 Links fragments 7 9

Can you please write a takeaway message about Entrepreneurship and Innovation

Venture hit a dead end Academic vs business landscape Hindsight Adaptability and resilience

How many openings to the digestive system does this organism have hint does it have an incomplete or a complete digestive system must enter a numerical value for credit Answer on yan RETU Time left 0 26 0 25 mm

Time left 0 27 Identify the following flowering plant as belonging to monocots or dicots and why Select one O dicot it has flower parts in groupings of four or five and netted venation O monocot it has flower parts in groupings of four or five and netted venation O monocot is has flower parts in groupings of four or five and parallel venation Oneither this is a magnoliid I don t have enough information to answer this question

Time left 0 2 True or false The micrograph seen here is of pine pollen which has a characteristic Mickey mouse head shape Select one O True

The specimen seen here is a dried plant sample mounted on paper as an herbarium plant museum sample Time left 0 28 10 Based on your knowledge of seedless plants identify the dominant life cycle stage of this plant group Is the specimen seen here the dominant lifecycle stage UNIVERSITY OF SOUTH FLORIDA HERBARIUM 110783 Asplenium cristatum Select one sporophyte dominant yes this is a sporophyte O gametophyte dominant yes this is a gametophyte O sporophyte dominant no this is the gametophyte stage O gametophyte dominant no this is the sporophyte stage

Match the phrases with the appropriate number on the specimen provided 2 Female sexual reproductive structure Asexual reproductive structure Non vascular structures that fasten organism to a substrate Main body tissues of the 2n generation Main body tissues of the In generation F Male sexual reproductive structure K Time left 0 34 3 Choose Choose Choose Choose Choose 4

Knowing that and Fig 11 The main difference between the absorption spectra of NAD and NADH is that the absorption spectra of NAD has a single peak at 260 nm while the absorption spectra of NADH has two peaks one at 260 nm and the other at 340nm and ENADH 6 220 M x cm 340 SNADH 260 14 300 M 1 x cm NAD 8260 18 000 M 1 x cm 1 and that absorbances are additive meaning that total absorption of light at any given wavelength is the sum of the absorbances the two or more substances would show if measured individually under the same conditions Therefore A260 total A260 NAD A260 NADH Calculate NAD and NADH concentrations M on the basis of A260 and A340 A260 0 75 A340 0 23 A Exl