Principles of Inheritance & Variation (Genetics) Questions and Answers

Match the following with the descriptions paracrine signaling Examples of second messengers Apoptosis endocrine signaling Choose Example of long distance signaling CAMP Inositol triphosphate calcium Programmed cell death example of local cell signaling Choose Choose

Homologous chromosomes carry the alleles of the gene or character and have the le same same different same Same Different 5 56 JCC

What is pleiotropy occurs when one gene influences many characteristics a single phenotypic character results from the additive effects of two or more genes two dominant alleles affect the phenotype

3 7 In humans normal skin pigmentation is due to a dominant gene A albinism to its recessive allele a A normal man marries an albino woman their first child is albino a What are the genotypes of the b Man Woman Child If they had more children what is the probability that they would be USE A PUNNETT SQUARE a normal b albino If a man that is heterozygous for brown eyes marries a woman that is heterozygous for brown eyes blue eyes are recessive a What is the genotypic ratio of the children b What is the phenotypic ratio of the children In humans right handedness is dominant H If a heterozygous right handed man marrie a left handed woman h a What is the genotypic ratio of the children b What is the phenotypic ratio of the children In humans the gene for tasting PTC is dominant A The brown eye gene B is dominant to blue b What proportion of the children of two parents each of genotype AaBb would be a brown eyed tasters b blue eyed tasters c brown eyed non tasters d blue eyed non tasters

Conjugation specialized transduction O Transformation O DNA replication Question 3 Which of the following connects adjacent nucleotides in DNA replication O ligase O helicase ORNA pol

Question 4 Which of the following is correct RNA polymerase copies DNA from the 5 to the 3 end DNA polymerase copies DNA from the 5 to the 3 end O DNA polymerase copies DNA from the 3 to the 5 end O DNA helicase copies DNA from the 5 to the 3 end Question 5 Where does translation occur inside the eukaryotic cell

Please match the following columns regarding mutations Point mutations Codon Valine becomes Alanine UAC becomes UAG stop Choose Choose ACGUU ACG a single base pair is changed Missense mutation Nonsense mutation a base pair could have been added or removed

Which of the following statements correctly describes alternative RNA splicing It can allow the production of different protein products from a single mRNA It is a mechanism that can decrease the rate of transcription It allows the production of similar proteins from different RNAs It is a mechanism that can increase the rate of transcription

Listen Which of the following statements correctly compares transcription in prokaryotes and eukaryotes RNA polymerase in both prokaryotes and eukaryotes produce the only mRNAs Both eukaryotes and prokaryotes recognize a polyadenylation signal in order to terminate transcription Prokaryotes have at least three types of RNA polymerases whereas eukaryotes only have one Bacteria have one type of RNA polymerase whereas eukaryotes have at least three

A particular triplet of bases in the template strand of DNA is 5 AGT 3 The corresponding codon for the mRNA transcribed is 3 UGA 5 5 TCA 3 3 UCA 5 3 ACU 5

B Make identical strands of DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TGT CTC TAT original new

Incomplete Dominance For all of the traits Mendel studies one allele was dominant while the other was recessive This is not always the case Two other inheritance patterns exist codominance and incomplete dominance codominance In codominance the alleles are neither I I result dark skin L traits i are created in the offspring nor medium skin As a I light skin WHITE R R ROAN R R Incomplete dominance In incomplets dominance the allele can t i fully overpower the 1 RED R R allele so the resulting trait is a of the two DNA Chromosomes What is a chromosome A chromosome is a structure found in the nudeer of a cell that an organism s is wrapped around Body cells have twice the i number of chromosomes as sex cells Half come from the egg cell and half come from the sperm cell Human 23 pairs of chromosomes 46 total Different organisms have different numbers of chromosomes Chimpanzee 24 pairs of chromosomes 48 total W Bananas 11 pairs of chromosomes s 22 total What is DNA DNA an abbreviation for deoxyribonucleic acid is the for building an organism Fruit fly 4 pairs of chromosomes 8 total

CCG GAT TTT AAT TAG CTA CTA TCG TAC TAC GTT GGT GCT original new Organism Human Cow Salmon Wheat Yeast The proportions of the bases are consistent within a species however they do vary between species Using the base pa rules complete the following table to show the percentage of each type of base in the five different organisms Adenine 31 28 32 8 23 27 31 Based on your results write a general rule that online the 22 new Percentage of each type of base Guanine Cytosine 19 19 complementary from 2A mount FATC and Ch 21 DYNEA Thymine 29

In a hypothetical plant assume that the color of the flower is under the control of a single gene Assume that the gene has two alleles the dominant allele R that corresponds to the color red and the recessive allele r that corresponds to the color yellow R Red r yellow Someone gifted you a plant with a red flower but you do not know for certain whether such plant is homozygous or heterozygous Rex Br CBS RE Br Br C RR x rr r 1 What type of cross should you perform to determine whether the plant is homozygous or heterozygous it is Heterozygous 2 You counted three offspring all with red flowers from the cross in question 1 You then concluded that your plant must be homozygous Two questions a Write a Punnett square that justifies such conclusion b What is the probability that your conclusion is WRONG i e your plant is instead heterozygous 3 Assume again that all offspring of the cross in question 1 are all red and that you conclude again that your plant must be homozygous How many offspring should you count to ensure that the probability of your conclusion being wrong is less than 0 001 i e you have less than 0 1 chance of being wrong

Can you please make a question about Genetic Mutations in your own words

Listen The lagging strand is synthesized using the DNA strand as a template 5 3

Errors in RNA synthesis are corrected by DNA polymerase II corrected by DNA polymerase III are more critical compared to errors in DNA replication corrected by RNA backtracking

Which of the following is NOT true regarding DNA polymerase It requires an RNA polymerase to initiate the synthesis of the polynucleotide It utilizes dNTPs to build the new strand It has proofreading activity It adds a new nucleotide to the 5 end of the existing chain

The alpha subunit of RNA polymerase binds 100 the 10 sequence O the up stream element O the 35 sequence the pincer

Termination of RNA transcription occurs when RNA polyemrase forms a hairpin with a short G C rich sequence is cleaved by an endonuclease reaches a stop codon is degraded by a protease 121

5 Met Pro GG Translation Translation Ser AUGCCUAGUCGGUAAAAA AA 3 Arg Met Phase AUGCCUAGUCGGUAAAAAAAAA 3

What is the START codon Can you locate the START codon above What is the function of the Shine Dalgarno Sequence Where is it located The Shine Dalgarno sequence is complementary to what What does the START codon code for What are the STOP codons Can you locate a STOP codon above

The recessive alleles for scute bristles s and ebony body e identify two autosomal genes on the third chromosome of Drosophila melanogaster When females heterozygous for these genes were crossed with scute bristled ebony bodied males the following classes and numbers of progeny out of 1000 were obtained wildtype bristles wildtype body 188 scute bristles wildtype body 307 wildtype bristles ebony body 313 scute bristles ebony body 192 What is the distanced between the s and e genes 18 8 map units 38 map units 0 5 62 man units

The recessive alleles for cinnibar eyes c and vestigial wings v identify two autosomal genes on the third chromosome of Drosophila melanogaster When females heterozygous at these two genes Cc Vv were crossed with cinnibar eyed vestigial winged males the following classes and numbers of progeny n 1000 were obtained wild type eye color wild type wings Wild type eye color vestigial wings Cinnibar eye color vestigial wings Cinnibar eye color wild type wings 46 map units Based upon these results the map distance between the cand v genes is estimated to be 8 map units 92 map units 42 4 map units 464 38 456

In the following cross P generation the genes are inherited independently not linked except for genes C and D which are completely linked and show no recombination AAbbccDD x aaBBCCdd What is the genotype of the F1 offspring AaBbCcDd

Can human males be carriers for X linked traits Yes because both males and females can express recessive traits Yes because the Y chromosome can carry the recessive allele No because males only have one copy of the X chromosome No because males don t have sex chromosomes

This is a picture of a male calico cat Which of the following must be true of this cat Select all that apply He is XXY His cells will have a Barr body 0 5 pts He has a functional SRY gene He is heterozygous for the coat color allele He lacks the XIST gene

0 5 pt You are working as a cytologist scientists who study cells and cell abnormalities and you are given some cells from a male patient You note that these cells all have a single Barr body You do further analysis and see that all cells also have a Y chromosome Which of the following must be true of this male patient The patient is XXY The patient is phenotypically female The patient should produce sperm with the normal chrorosome complement The patient will have hemophilia

The mechanism of entry of herpesviruses DNA into the nucleus of a host cell is similar to that of a HIV whose core particle partly uncoats phage T4 which injects its DNA into the bacterial host via high pressure idjection c plasmid F transfer during bacterial conjugation bl b d bacterial transformation e HIV transfer of virions via nanotubular connections

Which of the following molecules is NOT provided by the herpes simplex virus during host cell entry and replication a scaffold of microtubules b virion host shutoff factor Oc single strand DNA binding proteins O d proof reading endonuclease e DNA polymerase

RNA synthesis of influenza virus is primed by host mRNA containing 7 methylguanosine triphosphate obtained by O a the rolling circle mechanism b cap snatching c exocytosis d telomerase activity e endocytosis

The replacement of the genome of Mycoplasma capricolum with the modified genome of M mycoides is considered to be a significant accomplishment because it O a demonstrates that genetic manipulation of recalcitrant organisms is impossible Jay b enables gene editing of species Oc creates a riboswitch board d merges the genomes into a hybrid

Mapk pathway you make a variety of mutants and then express them in some stem cells Remember that this pathway is involved in cell division signaling in these cells Determine whether you think the following mutations could lead to an over proliferate cell phenotype for those stem cells A MapKK has what we call a phosphomimetic mutation with a Serine Aspartic Acid mutation at the site phosphorylated by MapKKK If this works as intended this mutation causes MapKK to always exist in what would be the phosphorylated state

B There is a phosphatase called PTEN that dephosphorylates PIP3 so that it becomes PIP2 What type of mutation in PTEN loss of function or gain of function would cause cells to potentially not undergo programmed cell death when they should be undergoing programmed cell death Explain your reasoning Then discuss whether this mutation could lead to a cancerous phenotype

Listen to this 60 seconds podcast and then answer the following question http www scientificamerican com podcast episode cfm id mammoth hemoglobin could provide co 11 09 19 ref worth What were the methods likely used for the analysis of the mammoth hemoglobin Mammoth DNA fragments encoding for the two globin subunits of hemoglobin were amplified using PCR X ray crystallography was used to determine the structure of the DNA encoding for the hemoglobin protein Hemoglobin protein in sufficient quantities was purified from the mammoth remains and the amino acid sequence was determined directly from the protein Sanger s chain termination sequencing was used to determine the sequence of the genes encoding the two globin subunits

The following is the DNA sequence coding for the hemoglobin beta subunit mentioned in the podcast What is the complementary strand s sequence Note that by convention and unless stated otherwise single stranded nucleic acids are always written with their 5 ends on the left 5 ATG GTG AAT CTG ACT GCT GCT GAG 3 Enter the nucleotides of the complementary strand in groups of three below pay attention to the orientation 5 3

3 Explain how the random alignment of homologous chromosomes during metaphase I contributes to variation in gametes produced by meiosis 20 pts

Geneticists have found that a particular SNP located in the second intron of the Hemoglobin gene is associated with sickle cell disease in an African population Indeed this SNP shows a higher frequency 68 in the population Geneticists also found that this SNP did not cause any amino acid change in the hemoglobin gene What is the most likely reason why this SNP is associated with a disease but not causing any functional change in the hemoglobin gene O This SNP is affected by genetic drift This SNP was found by an statistical error in the 68 of the population This SNP is linked to another mutation that is responsible of the disease O None of the above

O Primase Polymerase Topoisomerase Helicase Question 8 1 point 1 Listen Which of the following is NOT a nitrogen base in DNA O Uracil Guanine Adenine

Lucy and Jim have been married for 5 years and have decided they would like to try to have a child However a rare genetic disorder runs in both or their families so they decide to go to a genetic counselor to determine the chances that their future child will be affected The disease achondrogenesis 1a affects the ability of proteins necessary for bone and cartilage development to be modified and packaged properly after leaving the endoplasmic reticulum The results are devastating Individuals with this disorder are often stillborn or die soon after birth from respiratory failure Fortunately after doing a genetic screening the genetic counselor determined that while Jim is a carrier for this autosomal recessive disorder Lucy is not Therefore if they do have a child it is unlikely that their child will be affected

In a group of rose plants some individuals have light yellow flowers and others have dark yellow flowers this group the gene for the flower color trait has two alleles The allele F is for light yellow flowers and th allele f is for dark yellow flowers A certain rose plant from this group has light yellow flowers This plant has two alleles for light yellow flowers Based on this information what is this rose plant s genotype for the flower color gene FF light yellow flowers Submit dark yellow flowers Ff

Reminder click here for interactive practice questions before you do the Daily Check for this lesson The Daily Check score will determine if you need to review this information a bit more or if you are ready to dive deeper into this topic How does the structure of DNA relate to its function Organism F 000 Yeast Malzo Wheat Grasshopper Sea Urchin Octopus RAT Shuman KA G 313 16 7 171 747 26 0 757 736 105 101 517 488 268 22 8 23 2 27 2 0 99 0 98 29 3 27 3 22 7 728 27 1 1 01 1 00 20 5 20 7 30 2 17 6 T AT G C KGC 17 6 200 22 0 21 6 286 24 329 0 95 109 70 5 32 8 17 7 17 3 32 1 1 02 1 02 35 0 01 9 1 05 1 00 35 2 29 3 1 00 0 99 28 4 0 99 1 02 78 4 1 01 100 35 8 293 207 200 300 090 104 45 5 44 42 R AT 407 644 54 0 544 649 840 56 4 570 59 0 Loco Identify Look at the graphic State what you see notice happening in the image Interpret Look back at your statements now explain WHY or HOW what you noticed is occurring Caption Write a 1 2 sentence summary that combines your Identify and Interpret statements that would thoroughly describe this graphic to someone reading your caption

A rooster with gray feathers and a hen of the same phenotype produce 15 gray 6 black and 8 white chicks What is the most likely mode of inheritance of feather color in chickens Select What phenotypes would you expect in the offspring of a cross between a gray rooster and black hen Select

Question 19 In Labrador retrievers the allele for black coat color B is dominant to the allele for brown chocolate coat color b However if a lab has two copies of the recessive allele for a pigment depositing gene e it can only have yellow coat color In a cross of a black lab that is heterozygous for both gene B and E with a yellow lab whose parents were chocolate what fraction of the next generation would one expect to be yellow 1 8 0 5 pt 1 4

25 II 50 III MONO Affected Male Affected Female KEY Wild Type Male Based on this pedigree describing the inheritance of an autosomal dominant disease what probability that person A will birth an affected child if she mates with a wild type male Wild Type Female

The black chicken and the white roster are parents to the individuals in the middle image What type of dominance relationship most likely leads to these feather colors in chickens Complete dominance Incomplete dominance Codominance Pleiotropy W ES

Question 16 0 Fur color in Labrador retrievers is determined by two genes gene B for coat color and gene E f deposition of pigment Nose lip and gum color is determined only by gene B A yellow female with brown nose and gums is mated with a brown chocolate male whose mother was yellow What are their possible offspring yellow and brown all with brown noses yellow and brown all with black noses 1 3 yellow and 1 3 black and 1 3 brown all with black noses brown with brown noses and black with black noses

Question 6 is an example of a character that is controlled by more than one gene a quantitati character and demonstrates a continuum of phenotypes Pleiotropy Polygenic inheritance Epistasis Codominance 0 5 PRA

A gene that affects the expression of a second gene is an example of pleiotropy codominance epistasis polygenic inheritance incomplete dominance Question 2 PLA 0 5 pts

With the discover of the myriad roles that RNA plays in the cell and the work that many scientists have done on how to stabilize RNA make it less immunogenic and deliver it to cells inside the body RNA therapeutics is an important new frontier of biomedicine Do an internet search on RNA therapeutics to discover what is being done in this field explain what RNA therapeutics is give a brief history on it explain where this field of therapeutics is at and the challenges that it faces Provide the links to the sources you used to answer this question Also note that the 2023 Nobel Prize in Medicine was given to scientists that figured out how to make RNA less immunogenic which was important in the ability to use RNA as a therapeutic https www nobelprize org prizes medicine 2023 press release An interesting NY Times article about the difficult journey faced by Katalin Kariko https www nytimes com 2021 04 08 health coronavirus mrna kariko html