The Living World Questions and Answers
Biology
The Living WorldA heat watch is issued when the heat index is forecasted to be at or above
95 degrees Fahrenheit
105 degrees Celsius
95 degrees Celsius
105 degrees Fahrenheit.
Biology
The Living WorldRead the sentence.
The game of lacrosse seems complicated to me.
How does the word complicated function in the sentence?
predicate adjective
objective complement
indirect object
predicate nominative
Biology
The Living WorldHeat index, also known as apparent temperature, is the measure of how hot it really feels when relative humidity is factored in with the actual air temperature.
True
False
Biology
The Living WorldWhat you would expect to observe/not observe if the following modifications to the Lab 4 protocol (see Part I) were made. Provide a brief explanation for your observation?
Colchicine, a microtubule-depolymerizing agent, was fed to adult female flies expressing the kinesin-ß-galactosidase fusion protein
Biology
The Living WorldChoose the words or phrases that correctly complete the statement. Check all that apply.
All living things
reproduce by cloning.
grow.
need energy.
respond to stimuli.
are unicellular.
are made of cells.
Biology
The Living WorldWhat is leachate?
A drainage from abandoned coal mines that creates an orange-yellow film in the water
B polluted water from smokestack scrubbers
C filtered water that has been treated in a sewage treatment plant
D water produced by filtering through a landfill that often contains high amounts of organic matter and toxic chemicals
Biology
The Living WorldThe class sets out to do stream surveys of two local waterways.
In stream A, the students find a large number of leeches, aquatic worms, and Pouch Snails.
Based on this data, which stream would be considered healthier?
In stream B, the students collect one Stonefly larva, several Water Pennies, two Riffle Beetles, and a Dobsonfly larva.
A stream A
B stream B
Biology
The Living WorldThink about the animals in an arctic ecosystem. How would those animals adapt over time if global temperatures rise over the next several hundred years?
Biology
The Living WorldRead these paragraphs and answer the question that follows:
1. In 2008, more than one million American students gave nearly 20 million service hours to their communities. They made a difference in people's lives and learned some important life lessons in the process. Organizations, including schools, are actively promoting service for all citizens as a way to be involved, help others, and improve themselves.
2. Service is helping other people and being active in your community. For example, one group of teens planted a community garden with their friends. They grow a variety of vegetables. The garden requires regular care. The teens donate the produce to a local soup kitchen. Workers there use the produce to help feed people in the community. By tending the garden and donating their produce, the teens are actively helping make life a bit better for others in their community.
3. Service is valuable in ways that cannot be measured in dollars. People volunteer or serve others without expecting money or gifts in return. Service is not about earning money. It is not just collecting money to give to a group. It is about action and contributing to the common good. The people who serve as well as those who receive help benefit in many ways that are more important than money or gifts. For example, a soup kitchen provides essential food to people who may otherwise go hungry. The soup kitchen is extremely valuable for those struggling to get enough to eat. Those serving learn about compassion and how helping others can improve life for all.
4. Millions of Americans are making society better for themselves and for others. They are participating citizens in their community, raising up those who are less fortunate. In return, they become better people who can understand the perspectives and needs of others, which are invaluable and important qualities of good citizens.
Which sentence best represents the main idea of paragraph (2), the first body paragraph?
They made a difference in people's lives and learned some important life lessons in the process.
Service is helping other people and being active in your community.
It is about action and contributing to the common good.
The teens donate the produce to a local soup kitchen.
Biology
The Living WorldScientists studying an island chain discover several species of birds that are similar in appearance but occupy different niches. Some eat berries; others eat seeds; still others eat only worms.
This is an example of what? Select all that apply.
Punctuated equilibrium
Adaptive radiation
Convergent evolution
Gradualism
Biology
The Living WorldWhich of the following quotes most accurately describes the impact of the incorporation doctrine on the principle of federalism?
"...state and local governments were required to protect most rights in the Bill of Rights"
"States did not have to abide by the limits it placed on the federal government."
The 14th Amendment was "originally meant to protect the civil rights of newly-freed slaves."
"When the 14th Amendment was ratified...., it placed limits on the kinds of laws states could pass."
Biology
The Living WorldWhich of the following quotes most accurately describes the impact of the incorporation doctrine on the principle of federalism?
"...state and local governments were required to protect most rights in the Bill of Rights"
"States did not have to abide by the limits it placed on the federal government."
The 14th Amendment was "originally meant to protect the civil rights of newly-freed slaves."
"When the 14th Amendment was ratified...., it placed limits on the kinds of laws states could pass."
Biology
The Living WorldWhich of the following statements most accurately describes the Supreme Court's rational for the decision in McDonald v. Chicago
States may violate the Bill of Rights but citizens must be notified in a timely fashion so they can move if they choose to do so.
States are only able to create laws that have federal approval.
States do not have the ability to create laws that are in violation of the Bill of Rights.
States must first consult with the Supreme Court when making laws that could possibly contradict the Bill of Rights.
Biology
The Living WorldStevenson v. Davenport Community School District (2000) In 1992, Brianna Stephenson an honor roll student at West High School was suspended with a recommendation for expulsion for having a small cross tattoo between her thumb and pointer finger. West High School had been having a number of gang related issues many of which dealt with gang colors and tattoos. West High School administrators deemed he cross as a gang symbol and told Brianna she had to have it removed before she could return to school. Brianna paid to have the painful laser surgery to have the tattoo and filed suit against the school. The 8th Circuit Court of Appeals ruled that the school district's policy was unconstitutional. 1) the School's policy was not specific enough as to what conduct/expression was considered to be prohibited and 2) the vague policy invited unconstitutional, arbitrary and discriminatory enforcement. Based on the case above, which of the following statements most accurately explains why the court sided with Brianna?
Brianna's 1st Amendment rights (freedom of speech) were violated and her actions did not cause any disruptions to the day to day functioning of the school.
Brianna's 4th Amendment right (search and seizure) was violated since was forced to remove the tattoo.
The school has the right to prohibit students from having any type of tattoo within public school.
The court cited New Jersey v. T.L.O. to support their decision.
Biology
The Living WorldWhich argument is most strongly against the incorporation of the 14th Amendment?
The incorporation of the 14th Amendment has given the Supreme Court the ability to ensure that citizens rights/liberties are not violated.
The incorporation of the 14th Amendment has consolidated power between the government at the local, state, and federal level.
The incorporation of the 14th Amendment given the federal government too much power over the state's ability to govern.
The incorporation of the 14th Amendment may not benefit all Americans equally.
Biology
The Living WorldThe 2-Point Discrimination Test determines
the temperature threshold (in degrees C) where you can identify vibrations on the skin.
the temperature threshold (in degrees C) where you can identify cold temperature on the skin.
the touch threshold (in mm) where you can identify two points on the skin as two different points and not one.
the pain threshold (in mm) where you start to feel pain as a needle is inserted into the skin.
Biology
The Living WorldWhich of the following correctly describe kinesin (choose all that apply)?
Kinesin has a motor domain at the N-terminus of the heavy-chain.
Kinesin has a motor domain at the C-terminus of the heavy-chain.
Kinesin moves towards the positive end of microtubules.
Kinesin moves towards the negative end of microtubules.
None of the above
Biology
The Living WorldWhat is the purpose of soaking the Drosophila embryos in bleach?
Remove the chorion while leaving the vitelline membrane intact.
Remove the vitelline membrane while leaving the chorion intact.
Fix the embryo.
Stain the embryo greenish-blue.
Biology
The Living WorldHow do many oil drillers separate methane from the more desirable natural gas?
Collect the methane in a separate container
Mix the methane with water
Recirculate the methane back into the ground
Burn the methane creating a gas flare
Biology
The Living WorldType the correct answer in the box. Use numerals instead of words.
A population of squirrels living in a habitat covering 150 hectares is at 80% of the carrying capacity of 1,500. Assuming that the squirrels have a uniform distribution, what is the population density of the squirrels?
Biology
The Living WorldWhy would satellite imagery be more useful than a map in some instances?
a) provides landmarks, such as buildings
b) can be used when Internet is not available
c) takes more detailed images but only of very small areas
d) provides various methods of transportation to a location
Biology
The Living WorldWhich observational tool helped astronomers Arno Penzias and Robert Wilson discover the existence of the cosmic microwave background (CMB)?
A) optical telescope
B) radio telescope
C) a digital camera
D) space telescope
Biology
The Living WorldWhich quotation from chapter 2 of Night by Elie Wiesel best demonstrates the author's viewpoint about the dehumanization of the passengers?
a) "There are eighty of you in the car,' the German officer added. 'If anyone goes missing, you will all be shot, like dogs."
b) "On the first day of the journey, she had already begun to moan. She kept asking why she had been separated from her family."
c) "When they came back, they told us that they had learned, in exchange for a gold watch, that this was the final destination."
d) "But there was nothing outside but darkness. We returned to our places, shame in our souls but fear gnawing at us nevertheless."
Biology
The Living WorldThe Serengeti region of Africa contains a population of cheetahs and a population of lions. Studies have shown that the cheetah population has very low genetic diversity, while the genetic diversity of the lion population is quite high. The cheetah population is also much smaller than the lion population. Both populations are vulnerable to infection with a particular virus that can be fatal in both species. What is the most likely outcome if both populations are infected with this virus?
A) The lion population is more likely to survive because it is more likely to have individuals with traits to combat the virus.
B) The cheetah population is more likely to survive because there are fewer individuals for the virus to attack.
C) The cheetah population is more likely to survive because lower genetic diversity increases immunity to viruses.
Biology
The Living WorldAn advocate for limited government would most likely oppose the modern American bureaucracy for which reason?
A. The growth of bureaucracy has come at the expense of government corporations.
B. The bureaucracy has become so enormous that it is no longer efficient.
C. The use of civil service exams unfairly prevents leaders from using the patronage system.
D. The expansion of the bureaucracy has made Congress more powerful than the president.
Biology
The Living WorldA student wants to create a liquid volcano. The student observes bubbles in the soft drink prior to opening it. The student first proceeds to open the soft drink bottle and place it on the floor.
Next the student drops candy tablets into the drink using a rolled piece of paper, so that the tablets are able to fall into the drink continuously. The student notices a very powerful reaction as the drink fizzes and starts to bubble.
Biology
The Living WorldIn 1998, paleoanthropologist Rick Potts published an article in The Yearbook of Physical Anthropology, a peer-reviewed journal. The article was titled "Environmental Hypotheses of Hominin Evolution.” In his paper, Potts claimed that great variations in environmental conditions over time were responsible for the adaptability of humans and the success of our species. Which would most likely be found in his paper?
a) a review of modern human anatomical structure
b) evidence of changing environmental conditions, with references
c) the reasons competing hypotheses are wrong
d) his opinion of what will happen to the survival of the human race
Biology
The Living WorldIf a viral host cell has a mutation that interferes with the addition of carbohydrates to proteins in the Golgi apparatus, which of the following processes could likely result?
a) The viral capsid proteins would not have glycoproteins added to them and might not arrive at the host plasma membrane.
b) The viral core proteins would not have glycoproteins added to them and might not arrive at the host plasma membrane.
c) The viral envelope proteins would not have glycoproteins added to them and might not arrive at the host plasma membrane.
d) The virus would be unable to reproduce within the host cell.
Biology
The Living WorldWhich best completes this summary of the first paragraph of The Dark Game?
In 1861, many did not believe the Civil War would last long; however,
1. the first shot was fired on April 12
2. the fighting lasted four years
3. over 600,000 soldiers died
4. Fort Sumter was overtaken.
Biology
The Living WorldHOW do antimicrobial/control agents work (in other words- what are the things that control agents can DO TO bacterial cells to stop them from growing/ multiplying)?
Biology
The Living WorldFrom the options (a)-(e) below, choose the answer that best fits the following stateinent about cardiovascular function: Carries deoxygenated blood
a) Atrioventricular node
b) Vena cava
c) Aorta
d) Pulmonary vein
e) Sino-atrial node
Biology
The Living WorldThe inverted-U model of arousal includes all of these concepts
EXCEPT
A) Performance decreases as arousal levels become too high.
B) People perform better at moderate levels of arousal.
C) There is an optimal zone of arousal for performance.
D) The optimal level of arousal is the same for each person.
Biology
The Living WorldHorizontal, compressive deformation involves shortening and thickening of the crust.
True
False
Biology
The Living WorldWhich of the following statements is INCORRECT?
A) The cochlea is involved in balance and the vestibule and semicircular canals are involved in hearing.
B) Movement of the tympanic membrane is transferred to the fluid of the cochlea via the malleus, incus and stapes.
C) Waves of fluid movement inside the cochlea move the hair cells generating nerve impulses the brain interprets as sounds.
D) Louder sounds will create larger waves of fluid inside the cochlea and cause greater movement of the hair cells.
E) Three semicircular canals representing 3 different planes (up-down, forward backward and left-right) detect the orientation of the head.
Biology
The Living WorldCancer cells increase their dependence on glycolysis to meet their energy needs. Given this, which of the following statements will also be true of a cancer cell?
The citric acid cycle will be upregulated compared to normal cells.
Levels of fructose 2,6-bisphosphate will be high compared to normal cells.
Phosphoenolpyruvate carboxykinase (enzyme in gluconeogenesis) activity will be high compared to normal cells.
Activity of phosphofructokinase (enzyme in glycolysis) will be low compared to normal cells.
Biology
The Living World"Which classification would include cells that lack a nucleus, which live in extreme
conditions like hot springs and the Dead sea?"
fungi
bacteria
protozoa
archaea
viruses
Biology
The Living World16. Which result you may expect if TSI tube was inoculated with a colorless colony from
MacConkey agar?
A. Yellow butt/yellow slant, blackening
B. Yellow butt/red slant, blackening
C. Yellow butt/yellow slant, no blackening
D. Yellow butt/red slant, no blackening
E. Any of the above
Biology
The Living WorldWhat is needed to run high-throughput multiplexing (many different samples on the same flow cell) on short-read NGS platforms?
A. Unique Device Identifier barcodes on the plate wells
B. Unique Dual Index sequences on adapters that serve as molecular barcodes
C. barcoded sample prep beads
D. four-color fluorescent nucleotides
Biology
The Living WorldWhich groups of animals could be found in the tropical rain forest?
A) moose, elk, bears, grouse, and migratory birds.
B) small vertebrates, lots of invertebrates in the soil, birds, bears, and mountain lions.
C) a wide diversity of frogs, bats, monkeys, birds, insects, and snakes.
D) lizards, scavengers like vultures and hyenas, migratory animals.
Biology
The Living WorldThe following mRNA strand is being used to assemble a polypeptide strand by a ribosome: 59-AUGCUUGCUCAUCGGGGUUUUAA-39
(a) Write out the amino acids that will be assembled, in their correct order.
(b) Provide an alternative mRNA sequence with four or more changes that would translate to the same amino acid sequence.
Biology
The Living WorldWhich of the following gives you information about population density?
<IMAGE>
A. The number of births per year
B. The number of frogs in a pond
C. The number of deaths per year
D. The number of bacteria per square millimeter
Biology
The Living WorldMatch each of these methods used to encourage renewable energy use by consumers to their description below.
Distributional surcharge __________
Renewable portfolio __________
Green pricing __________
Biology
The Living WorldWhat is the threshold stimulus (V) in the upper forelimb muscle with a 80g load?
A. 8.0
B. 10.0
C. 9.0
D. none
Biology
The Living WorldTake the following DNA sequence.
tgagggctatcctagcgatgcaggttggag
a. Show what the other side of the DNA sequence would look like.
b. What would the mRNA strand made from this sequence look like?
c. A codon is a 3-nucleotide mRNA sequence that codes for an amino acid. How many CODONS does the mRNA strand from 'b' contain?
Biology
The Living WorldAll of the following metabolic changes would occur if breakfast is skipped following an overnight fast except for:
A. gluconeogenesis in liver
B. fatty acids are oxidized for energy
C. degradation of muscle glycogen
D. muscle protein breakdown
E. degradation of liver glycogen
Biology
The Living WorldWhy can some patients develop toxic responses to drugs even when their plasma levels are in the therapeutic range?
A. there is a higher level of the free fraction of the drug in the patient's plasma
B. there is a higher level of the bound fraction of the drug in the patient's plasma
C. drugs given before bed can become toxic
D. A toxic response can not occur if the drug is within the therapeutic range
Biology
The Living WorldWhich of the following groups of animals could be found in temperate grasslands?
A. bison, longhorns, burrowing animals, birds that nest on the ground, and foxes.
B. lions, rhinoceros, giraffes, and elephants.
C. migratory animals, oxen, caribou, and artic foxes.
D. deer, fruit-eating birds, lizards, and snakes.