Biology Questions

Match the fauna wave with when it persisted Cambrian fauna Paleozoic fauna Chrose started in the Ordovian decimated in late Perm started in the Cambrian but then slowly diminis started in early Mesozoic persists today

One of the following fixatives is good for lipid fixation O a Acetic acid O b Osmium tetroxide Chloroform Formalin O c O d d

What features distinguish small regulatory RNA SRNA from cis antisense RNA asRNA Features 6 items Drag and drop into the appropriate area below affects only one gene product Regulatory RNA 700 3000 nt in length intergenic SRNA 100 200 nt in length may have multiple targets as RNA found within coding regions

Which of the following are features of operons Select all that apply Choose one or more O A riboswitch OB promoter C operator OD poly U tail E protein coding genes stert odon ALG

In a tropical environment what might be different The quartz would have decomposed to clays The feldspar would have decomposed to clays Both quartz and feldspar would have decomposed to clays Nothing would be different

Which of the following statements is are TRUE i European nations had been colonizing for centuries and in the late 1800s began to focus on Africa for its raw materials and markets ii Britain France Belgium Italy Germany Portugal and Spain did not split the continent among themselves iii European nations staked their claims and signed treaties to reserve colonies and avoid wars

Identify each phrase as a characteristic of prokaryotes or eukaryotes Animals and plants Bacteria and Archaea Nucleus and mitochondrion Range from 10 100 um in diameter Average 1 0 m in diameter Prokaryotes Nucleoid and pili Eukaryotes SPR WAR

is the condition presented in the pedigree below autosomal dominant autosomal recessive or sex linked OPKU heterozygote carrier PKU homozygote 100 66 O sex linked recessive O Not enough information to determine O autosomal recessive O autosomal dominant

Now familiarize yourself with the library s webpage by following the instructions below a Go to the library webpage https library csub edu b In the search box type in Ecology This search will pull up all titles with the name Ecology c Find the link for Ecology Brooklyn New York N Y that is available at CSUB Library Periodicals Collection Level 2 i Is this resource a book or a journal This resource is a Journal ii From what years is Ecology available in hard copy in the library CSUB Library Periodicals Collection iii How many online databases do we have full text access to for Ecology iv Click on the JSTOR Life Sciences database What was the last year this database has for this journal v Do we have full text access to this journal past 2017

The most common element found in living organisms is Carbon Water Oxygen Calcium

SLIDE 5 14 Identify the structures labeled A 15 Identify the structure labeled B 16 Identify the tissue labeled C 17 Which layer of the skin is this hint what structures do you see that can help you decide C

B 12 Identify the structure labeled A 13 Identify the structure labeled B

Given the following three mRNA sequences determine which two code for the same protein Circle these two anscript anslate mRNA 1 mRNA 2 mRNA 3 AGU UUA GCA ACG AGA UCA UCG CUA GCG ACC AGU UCA AGC CUC GCC ACU CGU AGU

Please tell me this isn t happening exclaimed Sayen I m so sorry said Dr Sheng your grandfather s foot is infected Because of his diabetes he has poor circulation and by the time he finally sought medical attention it was too late We ll have to amputate the foot before the infection spreads further Don t you dare blame this on my grandfather Do you know why he didn t seek medical attention He doesn t have good health insurance He can t afford to run to the doctor every week I realize that There is nothing else we can do We have tried several antibiotic combinations The bacteria causing the infection are resistant to all of them He is stable for now but we re running out of time Ok I get it Can you please hold off on the surgery I want to talk to a friend Sayen turned to her grandfather Achak I have a friend who told me that his aunt s leg was saved using some weird treatment Let me ask him Achak looked at his granddaughter I know you want to help my child But it s too late No it s not please just let me talk to Daviti Achak stared out of the window of his hospital room Sayen saw him give just the slightest nod She raced out of the room to find a spot where her cell phone would have adequate reception Daviti It s Sayen I remember you told me how they saved you aunt s leg something about a virus They re about to amputate my grandfather s foot but his favorite thing to do is walk and climb I want to save his foot Yes My brother is a researcher at Eliava the Georgian bacteriophage institute They have the largest collection of bacteriophage in the world Before there were antibiotics treating wound infections with phage was more common But since the introduction of antibiotics research into phage treatment isn t done as much anymore I took my aunt to Georgia and they saved her leg How did they do that They took samples from her wound and cultured the bacteria to figure out what types of bacteria were causing the infection Then they cultured the bacteria mixing them with some of the bacteriophage they had success with in the past They made a mixture of a few of the bacteriophage that formed plaques on the culture and they applied that to my aunt s wound Every couple of days they would take new samples and try again Why did they do that asked Sayen Because sometimes the bacteria can become resistant to the phage It s much less likely if they use a mixture of phage but they wanted to keep track Her wound started clearing up by the next day It did take a while but they managed to save the leg by cleaning the wound regularly and applying mixtures of phage It s called phage therapy Do you think I can send them a sample from my uncle s leg in the mail No you cannot do that It s against the law to send bacteria through the mail Especially since they are obviously resistant to antibiotics The only way to do this is for your uncle to travel to Georgia But my uncle can t travel he s too sick Thanks Daviti I m going to talk to the doctor Sayen returned to the room Dr Sheng was still there just finishing up his examination of her grandfather She relayed to him what she had just learned Your uncle doesn t have time to travel to Georgia As far as I know there is no laboratory in this country that has such an extensive selection of phage and it is really really hard to get FDA approval for this type of therapy Well I want to try Who should I call first

You are part of a research team studying the kit fox population in the San Joaquin Valley You observe that the abundance of foxes varies depending on the presence of coyotes their main predator Your research team designs an experiment to compare the abundance of kit foxes for areas with and without coyotes n 10 sampling areas per area type Below are the data the team recorded for kit fox abundance for each area Provide your answers below in either blue red or purple to make your responses obvious to your instructor Submit this page to the lab assignment on Canvas Coyote 16 10 15 13 7 14 15 9 12 17 No coyote 20 17 25 27 22 19 26 30 24 25 1 What is the independent variable 0 5 pt 2 What is the dependent variable 0 5 pt 3 What are the null and alternate hypotheses 1 pt 4 Create an appropriately formatted descriptive statistics table as discussed in class Your table should include the mean standard deviation standard error of the mean and the lower and upper 95 confidence intervals for each habitat Do NOT include any other descriptive statistics in your table Your table cannot be handwritten 2 pt 5 Create an appropriately formatted comparison of means figure with caption in Excel as discussed in class Use 3 significant figures for decimal values Make sure to include 95 confidence intervals for error bars for each mean symbol 2 pt 6 Conduct a t test and report the results to determine if the groups of kit foxes are different 3 pt 7 Draw a conclusion based on your results 1 pt

Part 5 of 6 0 83 oints eBook Print References Intro to Graphing Cancer and smoking Looking at the Graph Data tab choose an appropriate dataset to learn about the relationship between smoking and different types of cancer Follow the interactive to choose the most appropriate type of graph and graph the data Based on the data you graphed what type s of cancer appear to have a positive correlation with smoking rates Multiple Choice Breast Lung Melanoma

nt 5 int rences Looking at the Graph Data tab choose the appropriate datasets to address the following statements and graph the data Match each statement below to the type of cancer it best describes 1 Common but often survivable Click to select 2 Rare but often lethal Click to select 3 Rare in men more common in women Click to select 4 Incidence rates correlate with smoking rates Click to select 5 About twice as common in men compared to women Click to select

b aaBBccdd c AaBbCcDd 50 Hint don t do a tetrahybrid cross do monohybrid crosses for each gene then use the multiplication rule 3 Approximately 4000 years ago a small number of people settled in areas of Finland and became separated from the rest of the population These people reproduced but due to the low number of people it caused a loss of genetic diversity in the subsequent offspring which caused many disorders to arise These disorders are collectively known as Finnish heritage diseases This event was so significant that even today one in five Finnish people carry at least one gene related to a Finnish heritage disease A man and a woman both of Finnish heritage are aware of this so they see a genetic counselor They are interested in having a child but fear they may pass on a disease They have their DNA analyzed and it comes back that they are both carriers for the recessive disease known as megaloblastic anemia a type of anemia common in Finnish descent Thankfully if they have an affected child it is treatable a What is the probability that if they have a child it will have megaloblastic anemia b Let s say they decide to have three children total What is the probability that all three AABE Show w

20 Please list and explain the 4 different levels of proteins structure Protein Structure

origin of the earth earliest known solid crust origin of life earliest know fossils 2 Next arrange on it the events listed below If an event is discrete such as the earliest known fossil simply list the event and date next to the appropriate spot on the timeline or use an arrow to point to the location of the event on the timescale If the event is something spread out over a range of time express it as a line representing the duration of the event e g deposition of BIFs span of BIF deposition first indication of build up of oxygen in the oceans atmosphere i e first red beds earliest known eukaryotes Snowball Earth earliest preserved multicellular ecosystems e g Ediacara faunas Hadean Archean Proterozoic

Which event could explain the changes in the population shown in the graph OA Over several generations the proportion of light colored moths stayed constant but mutations produced new phenotypes that were not included in the study B Over several generations light colored moths became more common because the tree bark became lighter in color as pollution decreased in the habitat C Over several generations dark colored moths became more common as the trees in the habitat became coated in soot pollution OD Dark colored moths became more common because populations have random variations in phenotypes from year to year

2 The basic hypothesis that we re working with for the formation of BIFs is that during the Hadean and Archean iron Fe accumulated in the oceans until the oceans were saturated with Fe i e the water could hold no more Then when oxygen 0 was introduced the Fe reacted with the O and precipitated until there was no more Fe left in the oceans

1 Most BIFs are banded which indicates episodic precipitation of hematite Make a conjecture about why this pattern exists Hint Remember that the precipitation of hematite depended on oxygen supply What might cause the oxygen supply in the Late Archean Early Proterozoic oceans to fluctuate on a regular basis Where does the oxygen come from What climatic variables might effect this source

I Does the size of acritarchs support the interpretation of them representing eukaryotes

6 cm 10days x 365 days I year

purple and sulphur bacteria 1 List one of the metabolic reactions that cyanobacteria use cyanobacteria fermenters

1 Identify the following metabolic reactions from the list provided FeS H S FeS2 H chemical energy 2H S CO2 light CH O H O 2S H O CO light CH O 20 CH O 20 H O CO chemical energy 6CH 0 2C3H6O3 chemical energy fermentation chemolithotrophy anoxygenic photosynthesis oxygenic photosynthesis aerobic respiration

PRE LAB QUESTIONS Read through the lab introduction and procedures and answer the following questions a How does the movement of molecules compare between solutions at room temperature versus 45 degrees Celsius b Which solution would have a faster rate of diffusion What is osmosis C d This movement or diffusion of water across a membrane is called e What is a concentration gradient f What is meant by a steeper concentration gradient g Elodea is a plant that lives in fresh water ponds The pond water has a lower concentration of dissolved particles than inside of a cell so fresh water will tend to move into the cell Is freshwater hypotonic isotonic or hypertonic compared to the Elodea cells h You can tell that the water fills the whole cell because the green chloroplasts are free to spread everywhere even out to the edges against the cell wall Would a cell in fresh water be considered lysed turgid crenated or plasmolyzed Explain PART 1 OSMOSIS AND TEMPERATURE 3 Hypothesis regarding the relationship of the rate of osmosis and temperature

Table 1 Osmosis and Temperature Results Initial Weight g Final Weight g Weight Change g Change 60 Karo s dyed blue 60 Karo s dyed blue 23 31 22 24 Strinew scol b How does the percent weight gain of the artificial cell relate to the rate of osmosis C Based on your results summarize the rate of osmosis and temperature d What are the dependent and independent variables in this experiment Initial Weight g Final Weight g Weight Change g Table 2 Osmosis and Concentration Gradient Results Change PART 2 OSMOSIS AND CONCENTRATION GRADIENT a Hypothesis regarding the effect of different concentration gradients on the rate of osmosis 80 Karo s dyed red 24 77 OM diH 0 16 83 0 1M 6 07 PREGN Sucrose Concentrations 0 2M 0 4M 0 6M Bo finia sPERSO Buzos HAS b Which sucrose solution of yours caused the potatoes to have the greatest weight gain 0 8M

Regarding the MNS blood group which point is correct O Anti M and anti s are a cause of HTRS O Anti M and anti S are lgG O Anti s and anti S are a cause HTR O None is correct O Anti M Ant N Anti S and Anti s are a cause HTR

Master mix 1 GFP pUC19 F 5 CCAGGCTTTACACTTTATGCTTCC 3 GFP PUC19 R 5 CTTTGATTCCATTCTTTTGTTTGTCTGCC 3 Master mix 2 GFP PBR322 F 5 GATGACGATGAGCGCATTGTTA 3 GFP PBR322 R 5 CTTTGATTCCATTCTTTTGTTTGTCTGCC 3 Reagents Sterile water Taq buffer dNTPs Forward primer Reverse primer Bacterial DNA Taq polymerase Stock concentration 10X 2mM 2 M 2 M Final concentration 1X 0 2mM 0 2 M 0 2 M Final volume Volume L 1 reaction 2 L 1 L 20 L 7 reactions 126 L Question Fill in the required volumes for the PCR table above 6 Place your labelled PCR tubes in the PCR machine closest to you Once you and the group opposite you have loaded your tubes into the machine program the following conditions

How does natural selection influence which traits are passed on to future generations OA Traits that increase the diversity of the population are more likely to be inherited B Traits that help organisms survive in their environment are more likely to be inherited C The traits that are more common will always be more beneficial OD Traits are randomly passed on from parents to offspring

Some hares have the same coat color all year long Others have white coats in the winter and brown coats in the summer Variations in their influence when individuals begin to grow the different coat colors A region genes with snowy winters has started experiencing later arrival of snow Which type of hare is most likely to increase in future generations of the population A Hares that grow a brown coat earlier in the spring B Hares that have a white coat all year C Hares that grow a white coat later in the fall D Hares that have a brown coat all year

Identity Cultural Narrative 10 pts For this first writing assignment students will reflect on how race ethnicity language culture gender sex and sexuality have shaped their identity Some essential questions to stimulate student s intellectual curiosity Personal Identity How do you define your identity and What aspects of your identity do you feel most connected to Cultural Background What cultural traditions or practices are significant to you and community Language and Communication How does language play a role in your identity and How do you navigate communication in socially and linguistically diverse settings Social Justice and Advocacy Are there social justice issues that align with your social locations race class gender and sexuality to name some and How do you engage in advocacy for historically marginalized communities Writing expectations and conventions This assignment must be two pages long double spaced with one inch margins and typed using 12 font Times New Roman Please ensure you follow the above formatting instructions outlined in this assignment Please proofread for writing challenges grammar punctuation and NED 00107

BIU Question 2 ET T Would it have been possible to determine the identity of the unknown if a whole egg was used instead of only the albumin Explain you answer noting that egg yolks contain lipids and proteins H 0 Word s T T 0 Word s

Question 2 Did the Benedict s test of reducing sugars for the glucose and milk samples indicate similar sugar content Reference Data Table 1 and Photo 1 in your explanation T T 0 Word s

Please list and explain the functions of the 5 main types of proteins 18 allilled al Jig so

Passive Transport a type of passive transport where molecules move from a region of high concentration to a region of low concentration the diffusion of water through a partially permeable membrane from a region of high concentration of water to a region of low concentration of water the concentration gradient with the assistance of a channel protein the passive transport of molecules or ions down Active Transport Active transport is the movement of molecules or ions from a region of concentration to a region of Transport of Large Particles space Active transport is powered by the molecule In order to move substances like ions against their transport proteins change their concentration that requires the expenditure of in response to ATP activation the process of cells secreting particles to the extracellular space the process of cells taking in substances from the extracellular the process of cells engulfing pathogens or debris the process of cells taking in fluids from the extracellular space

An solution is when the concentration of solutes is the same inside the cell compared to the surrounding solution Water molecules are in a dynamic meaning that there is equal movement of molecules in and out of the membrane A solution is when the concentration of solutes is higher inside the cell compared to the surrounding solution In this case H 0 will diffuse the cell A solution is when the concentration of solutes is lower inside the cell compared to the surrounding solution In this case H 0 will diffuse the cell H O H O In contrast a membrane pushes against the H O In plant cells loss of water from the vacuole causes cells to become happen in a solution solution would cause the cells to become Vacuole This would where the cell Passive Transport a type of passive transport where molecules move from a region of high concentration to a region of low concentration the diffusion of water through a partially permeable membrane from a region of high concentration of water to a region of low concentration of water the passive transport of molecules or ions down the concentration gradient with the assistance of a channel protein Active Transport Active transport is the movement of molecules or ions from a region of concentration to a region of Active transport is powered by the molecule In order to move substances like ions against their transport proteins change their Transport of Large Particles concentration that requires the expenditure of space in response to ATP activation the process of cells secreting particles to the extracellular space the process of cells taking in substances from the extracellular the process of cells engulfing pathogens or debris the process of cells taking in fluids from the extracellular space

Question 8 This diagram shows an reaction Free energy time products reactants

Listen What do chloroplasts and mitochondria have in common that no other organelle contains What does this provide evidence for Explain

2 Although they had been talking online for six months John felt some trepidation about meeting Luisa face to face Past girlfriends had called him insensitive and one had even claimed he was thoughtiess In this context what is a synonym for insensitive O A Understanding O B Complex OC Inconsiderate OD Receptive

All of the following are true about the Tuskegee Syphilis Study EXCEPT a Information related to treatment was withheld from participants b Participants were treated with penicillin when it was determined to be a cure for syphilis in 1947 O c 399 Black males who already had syphilis were recruited for the study d Participants were told that they could not go elsewhere for treatment

Choose two types of lateral gene transfer to compare and contrast the type of genetic information that is transferred the mechanism of transfer and under what conditions each type of transfer would be beneficial

on 1 Match each reagent to the macromolecule it identifies Benedict s reagent tt Biuret s reagent IKI solution Sudan III reagent Dische diphenylamine Reducing sugars Starches Lipids Proteins DNA IIIII Question 1

nique let you isolate two mixed species from a mixed species culture b How can you be sure you have a pure culture of one species And why is getting a pure culture important c What would happen if you didn t sterilize the loop between streaks 1 3 bni 20 d Discuss the biology of the one additional species of bacteria we worked with in this part of the lab Where are they found and what role if any do they play in human health and disease glom

b Why do you flame the mouth of the tube and heat the loop to red hot c What would your results have looked like if you forgot to sterilize the loop after inoculating the Serratia and before gathering the sample from Kokuria d What do you think are the benefits to storing bacteria on a slant versus a flat agar tube Discuss the biology of the two species of bacteria we worked with in this part of the lab Where are they found and what role if any do they play in human health and disease

AOTD What type of stimuli are detected by the ampullae of Lorenzini in hammerhead sharks Photons Tastes Electricity Smells

Which of the following is depicted in this figure of nutrient cycles and energy flow in a terrestrial ecosystem below Sun Respiratory loss work and heat Organic storage Gaseous exchange Net primary production Nutrient pool Gaseous exchange Herbivores Community respiratory loss Decomposers C Carnivores Nutrients are recycled while energy flow is one way Energy flow begins with organic storage and then cycles its way to the nutrient pool Carnivores give both nutrients and energy to herbivores

ation Spicules Choanocyte Archaeocyte create water currents and engulf food particles Based on your reading match the sponge cells to their individual functions protective and contractile variety of functions such as digestion secrete collagen Pinacocyte Collencyte Mesohyl 1 Pinacocytes 2 Choanocytes 3 Archaeocytes 4 Collencytes