Biology Questions
The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.

Biology
The Living WorldIn DNA the amount of guanine is always less than the amount of cytosine 1 point True False In DNA the amount of adenine is always greater than the amount of thymine True False A n eukaryote is a single celled organism that does not contain membrane 54 1 point bound organelles True 1 point False

Biology
Anatomy of Flowering PlantsA change in the genetic code of an allele is called a pedigree True O False The larger the number of individuals in a population the greater the influence of genetic drift O True O False Evolution is the change in the genetic makeup of a population over time O True False 1 point 1 point 1 point

Biology
Human Physiology - Locomotion & Movement1 In human biology you learn about your body 2 Bones give your body shape 3 Muscles move bones 4 You have five senses 5 The brain pumps blood through the body Fill in the missing words 1 You get the energy you need from 2 Your 3 The 4 1 5 Sight is one of your five bones food help you to move muscles blood pumps blood through the body brain heart brain hea When you think you are using your Underline the answer to each question 1 What moves your arms and legs muscles blood 2 What helps you think and feel brain bones 3 What lets you know what is going on around you bones se 4 What carries materials through the body muscles blood 5 What pumps blood through the body brain heart Answer the questions 1 When is your body working 2 What is biology What are the five con hearts senses

Biology
EvolutionIn garden pea plants the allele for inflated pod shape I is dominant over that for constricted pod shape i Consider a cross between a garden pea plant that is homozygous for inflated pod shape and a plant that is homozygous for constricted pod shape What is are the only possible genotype s of the offspring O II or ii O li O II O II li or ii Who is considered the father of taxonomy O Edward O Wilson Paul Herbert Charles Darwin Carl Linnaeus 11

Biology
Molecular Basis of InheritanceWhich statement about DNA is true DNA consists of two strands that run in opposite directions DNA has exactly two nitrogenous bases Thymine and guanine are complementary bases Each DNA nucleotide consists of three nitrogenous bases and a sugar

Biology
Biological ClassificationWhich statement is true regarding the pairing of bases in DNA O Cytosine is always bonded to thymine O Thymine is always bonded to adenine O Adenine is always bonded to cytosine Adenine is always bonded to guanine Which of the following is an example of a heterotroph O algae tiger moss flower

Biology
The Living WorldIdentify each statement as true or false RNA polymerase binds to the template strand of the DNA molecule tRNA forms the small subunit of a ribosome Frameshift mutations occur when one nucleotide is substituted for another in DNA Some point mutations result in changes to translated polypeptides while other point mutations have no effect on translation True False

Biology
The Living WorldIf a cross is conducted between two heterozygous round seed plants Rr the probability of producing a round plant is 75 If a cross is conducted between two heterozygous green pod plants Gg the probability of producing a green pod plant is 75 What is the probability of producing a round seed green pod plant from a cross between two heterozygous round seed green pod plants O 75 O 25 O 56 25 O 37 5 A new mountain range forms separating populations of species whose members do not travel over mountains The species evolves into two distinct species What is this an example of O sympatric speciation O coevolution O allopatric speciation macroevolution 1 point 1 point

Biology
BiomoleculesWhich term refers to the evolution of similar traits in distantly related species divergent evolution convergent evolution adaptive radiation coevolution Each normal human possesses in his or her body cells 2 pairs of sex chromosomes and 46 pairs of chromosomes O2 pairs of sex chromosomes and 23 pairs of chromosomes 1 pair of sex chromosome and 46 pairs of chromosomes 1 pair of sex chromosome and 22 pairs of chromosomes Sen 32 31 1 poil 1 po

Biology
The Living WorldWhich term describes an individual that carries two of the same alleles for a given characteristic phenotype O heterozygous homozygous O genotype Due to similar behaviors of genes and chromosomes we can conclude that O Genes and chromosomes perform similar functions O Homologue chromosomes separate during mitosis O Genes linked on the same chromosome are sometimes separated Genes are located on chromosome 1 point 1 point

Biology
Ecology - Organisms & PopulationWhich of the following is an example of an autotroph tree dog bird elephant Which statement about species diversity is true 1 point 1 point The greatest species diversity exists in ecosystems with many different species that each have small populations The greatest species diversity exists in ecosystems with many different species that each have large populations The greatest species diversity exists in ecosystems with fewer types of species that each have small populations O The greatest species diversity exists in ecosystems with fewer types of species that each have large populations

Biology
Biological ClassificationWhich characteristic of the garden pea made it a good choice for Mendel s 1 point genetic experiments The garden pea has only one characteristic that varies OGarden peas only reproduce through the process of self pollination The pea plant has seven observable characteristics that are expressed in exactly two ways O The reproduction process for the garden pea occurs slowly Which statement is true regarding a dihybrid cross O A dihybrid cross has no relationship to a monohybrid cross A dihybrid cross involves two genes and up to four alleles A dihybrid cross involves two genes and exactly two alleles A dihybrid cross is exactly the same as a monohybrid cross 1 point

Biology
The Living WorldWith which condition is an adult unable to digest the sugar in milk sickle cell anemia Huntington s disease Parkinson s disease O lactose intolerance Which term describes a single celled organism that contains membrane bound organelles O autotroph eukaryote Oheterotroph O prokaryote 1 point 1 point

Biology
Animal KingdomWhat is shown in this illustration 2 dichotomous key phyla binomial nomenclature phylogenetic tree bill elongated bill not elongated bill strongly curved bill straight bill straight bill strongly hooked bill uniform in width ible heron bill greatly widened at end spoonbill cardinal eagle 1 point

Biology
BiomoleculesWhich is the longest phase of the cell cycle O Interphase O Metaphase O Anaphase O Telophase The genotype defines O The physical appearance of an organism O One allele of a gene The combination of two alleles All of the above

Biology
Principles of Inheritance & Variation (Genetics)A garden pea with a purple flower is crossed with a garden pea with a white 1 poin flower and produces offspring all of which have purple flowers The offspring then self pollinate Based on the results of Mendel s experiment out of 1000 garden pea plants in the F2 generation approximately how many plants would have white flowers 250 plants 750 plants 0 plants 1000 plants

Biology
The Living WorldAnswer THREE of the following questions writing a good paragraph for each You must answer most parts of each question in any order but make sure that your paragraph flows together and is not choppy 1 Daydreaming Holden s stream of consciousness narration lets us into all his thoughts and even his weird daydreams like the one right after Maurice punched him and he fantasized revenge and Jane coming to take care of him What about you Keep your paragraph school appropriate please but do your fantasies ever involve your being a hero a sports star a villain a celebrity Do movies influence your daydreams Why do you think people imagine such scenarios that are very removed from their normal lives Or are your daydreams much tamer and much less spectacular 2 Emotions Holden says I never care too much when I lose something But we know he does Why is it so hard for people to talk about their feelings To admit that they messed up To admit that they are sad or need help Do you have someone you can really be honest with What kind of feelings are difficult for you to talk about or admit Are you a good listener if somebody else wants to talk about their feelings or do you feel uncomfortable 3 Regret So many times in this section Holden immediately regrets his actions or words With Sunny With Sally Do you find yourself saying and doing stuff that you feel bad about afterwards Are you stuck in a rut with the way you interact with some people With the way you talk to your parents and the things you fuss about with them Do you wish things could be different What can you do to make a change or to be a better person like you know you can be 4 The Ideal Escape Holden tells Sally he wants to go north and get a cabin in the woods and live there with her Just to get away from it all School and stress and parents and responsibilities Sally realizes that it s a crazy dream and that makes Holden angry How about your ideal get away from it all ideal escape It doesn t have to be completely doable Just explain where you would like to go and what you would like to do when the pressure builds up and there does not seem to be an end in sight 5 Generosity Believe it or not Holden has a very compassionate side A giving side And he notices things a lot Like the nuns breakfast or his friend s shabby suitcases What about you Would your friends say that you are generous with your stuff Do you lend people things or money Do you give thoughtful presents What is the coolest thing anybody has ever done for you What is the nicest thing you have done for or given to somebody else Do you have to orous 36 an adult

Biology
Molecular Basis of Inheritanceatch each term with the best description Codon DNA Nucleotide Transcription Translation Composed of two chains of nucleotides wound in a double helix The process by which a single strand of RNA is synthesized from DNA Triplet of nucleotides containing the instructions for the production of amino acids The process by which proteins are formed from the genetic code of mRNA Molecule consisting of a phosphate group sugar group and a nitrogenous base

Biology
BiomoleculesCategorize each statement as true or false The SI V Scope is a virtual microscope program which simulates the use of a compound light microscope The stage adjustment knobs are used to center the slide on the stage prior to focusing The V Scope should be used whenever a microscope is called for in the procedures of a lesson Virtual slides are located in the view slide tab True False

Biology
Animal KingdomAOTD What is the primary purpose of a tiger s striped body appearance To regulate body temperature To blend in with their surroundings for hunting To attract mates To scare away predators

Biology
Principles of Inheritance & Variation (Genetics)Listen This figure showcases haplodiploidy in honeybees In this case the female worker bee shown is noted on the figure as Self Use the figure below to select which of the following apply to the figure Brother 25 Full sister 75 Nephew 375 Mother Father Mate Niece 375 Self Son 5 Mate Daughter 5 Each daughter of a malentains all his genes Each father will contribute at least half of its genes to its son that will then transport one fourth of its genes to its grandson The relatedness of the female worker bee Self to a brother is only 25 because the brother is fatherless Full sisters relatedness is 0 75 to the female worker bee Self because full sisters receive 75 of their genome from the same father Females are diploid and come from fertilized eggs while males are haploid and come from unfertilized eggs

Biology
Animal KingdomWhat is the result of The Great American Interchange as indicated in the figure below Genera from North America and South America both invaded the opposite hemisphere places Genera from North America remained there but genera from South America migrated north Only mammals migrated to North America The animals showed in the figure are the only animals that migrated during this interchange

Biology
Cell: The Unit of LifeThe enter site of the Golgi apparatus is referred to as the site is pointed toward the region and the exit site as the and the exit toward the The

Biology
Cell: The Unit of LifeMatch the structure with the appropriate cytoskeletal filament Choose MT for microtubule MF for microfilament IF for intermediate filament cellular tracks stress fiber nuclear lamina Choose Choose Choose K

Biology
BiomoleculesWhich proteins are not synthesized on ribosomes bound with the RER membranes Select one a membrane b antibodies O c cytosolic d proteins of the extracellular matrix

Biology
Ecology - GeneralChoose the correct answer The cytoskeleton of a cell can generate movements via structures such as contractile ring or flagella Which cytoskeletal elements are linked with these two structures Select one a microfilaments and microtubules respectively b microtubules and intermediate filaments respectively c intermediate filaments and microtubules respectively d microfilaments and intermediate filaments respectively

Biology
Biotechnology: Principles and ProcessesThe total magnification of a light microscope equipped with a 5x ocular and a 10x objective is Select one a 60 b 100 c 50 d 200 e 500

Biology
BiomoleculesAmong the proteins released by regulated secretion in which secretory vesicles are stored inside the cell until a receiving of the signal for exocytosis are Select one a collagen b components of plasma membrane c components of extracellular matrix d peptide hormones e g insulin glucagon

Biology
Biological ClassificationPeer reviewed scientific journal CDC website WHO website Influencer blog Question 6 1 point Listen True or False Non enveloped viruses are lacking a lipid bilayer True

Biology
Ecology - GeneralPlace the viral infection steps in the correct order Entry Assembly Synthesis Release

Biology
Ecology - GeneralTrue or False Only enveloped viruses may have glycoproteins True False Question 8 2 points Listen For Ebola which of the following genes would be considered non structural VP40 SGP ONP

Biology
Microbes in Human Welfareatch the viral entry step with what is happening Occurs via injection of genome into host cell fusing with host cell membrane to transfer genome or through endocytosis of virus by the host cell The host cell assembles all of the viral proteins and genomes into a new viral particle that is ready for release Where virus leaves the host cell by budding exocytosis or lysis Viral genome is released into the host cell and uses the host cell machinery to make viral proteins and genomes necessary for replication Viral particle uses its protein coat and or envelope proteins for 1 Attachment 2 Entry 3 Synthesis 4 Assembly 5 Release

Biology
Biological ClassificationPlace the viral infection steps in the correct order Entry Assembly Synthesis Release Attachment

Biology
Microbes in Human WelfareOf the following what would not be considered a reliable scientific resource Peer reviewed scientific journal CDC website

Biology
Biotechnology & its ApplicationsTrue or False Only enveloped viruses may have glycoproteins True False

Biology
Biological ClassificationWhen DNA sequences are used for phylogenetic analyses each nucleotide position can be considered a trait Using the data provided below 57 bases from the mitochondrial DNA sequences of three chameleons and one lizard map ONLY the synapomorphic traits onto the phylogenetic tree provided below Note the horizontal branch on the tree where each trait transition takes place by using a line and the number of the base base numbers can be determined using the 10 50 marks above the sequence As an example of how I want you to map the traits onto the tree I have chosen a trait that is NOT synapomorphic and mapped it onto the tree position 10 the trait in question is an A in the lizard and two species of Brookesia and transitions to G in Chamaeleo After mapping all of the synapomorphic traits count the total number of trait transitions required to support this tree and note this number next to your tree If you are not sure which traits are synapomorphic read the material in the tan box that starts on page 214 of the text and is entitled Phylogenies from DNA sequences NOTE the tree only shows the three chameleon species leaving out the lizard Uromastyx outgroup that is included in the DNA data so you can evaluate which base is ancestral for each position Uromastyx B theili B brygooi C feae 10 T 20 1 30 1 40 1 50 AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCOCACAACAAACACAATTT Brookesia theili

Biology
Ecology - Organisms & PopulationRecombination frequencies can be easily calculated by adding the number of offspring that are different from the parents then dividing by the total number of offspring Let s say you are studying fruit flies and you cross a wild type grey female with a vestigial black male The F offspring are as follows 650 wild type grey 595 vestigial black 107 wild type black and 91 vestigial grey What is the recombination frequency between the genes for wing type and body color

Biology
Biotechnology: Principles and ProcessesBased on the graph what can you conclude Other density sightings day 125 100 75 50 25 0 25 50 Kelp abundance Cover 75 100 More information is needed to determine the relationship between the otter population and the abundance of kelp Based on the graph a relationship between the otter population and the abundance of kelp does not exist There exists a negative relationship between the otter population and the abundance of kelp There exists a positive relationship between the otter population and the abundance of kelp

Biology
Ecology - GeneralWhen DNA sequences are used for phylogenetic analyses each nucleotide position can be considered a trait Using the data provided below 57 bases from the mitochondrial DNA sequences of three chameleons and one lizard map ONLY the synapomorphic traits onto the phylogenetic tree provided below Note the horizontal branch on the tree where each trait transition takes place by using a line and the number of the base base numbers can be determined using the 10 50 marks above the sequence As an example of how I want you to map the traits onto the tree I have chosen a trait that is NOT synapomorphic and mapped it onto the tree position 10 the trait in question is an A in the lizard and two species of Brookesia and transitions to G in Chamaeleo After mapping all of the synapomorphic traits count the total number of trait transitions required to support this tree and note this number next to your tree If you are not sure which traits are synapomorphic read the material in the tan box that starts on page 214 of the text and is entitled Phylogenies from DNA sequences NOTE the tree only shows the three chameleon species leaving out the lizard Uromastyx outgroup that is included in the DNA data so you can evaluate which base is ancestral for each position Uromastyx B theili B brygooi C feae 10 20 30 40 50 AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT Brookesia theili Brookesia brygooi

Biology
The Living WorldMatch the metabolism to the correct chemical reaction Note that I can t use subscripts in these answers every number that follows a chemical symbol treat as a subscript lithotrophy fermentation anoxygenic photosynthesis oxygenic photosynthesis aerobic respiration Choose 2H2S CO2 light CH2O H2O 2S CH20 20 H2O CO2 energy FeS H2S FeS2 H2 energy 6CH202C3H603 energy H2O CO2 light CH2O 20 Choose Choose Choose

Biology
EvolutionWhat does the presence of cyanobacteria in the earliest known stromatolites indicate about evolution of life on earth up to that point in time Study the tree before composing your answer and make sure to reference aspects of the tree in your discussion such as the sequence of branch points to support your answer Bacteria Flavobacteria Cyanobacteria Thermotogales Green 000 sulfur bacteria Archaea Euryarchaeota Methanosarcina Methano bacterium Gram Purple positives Crenarchaeota Methanococcus bacteria Thermoproteut Pyrodiction Thermococcia celer Eukarya Entamoebae Slime molds Halophiles Animals Fungi Plants Ciliates Flagellates Trichomonads Microsporidia Diplomonads

Biology
Cell Cycle and Cell DivisionMatch the event with the correct age origin of the earth solid crust forms oldest known earth materials oldest known fossils Choose 4 4 Ga 3 6 Ga 4 0 Ga 4 6 Ga Choose Choose

Biology
The Living WorldLateral gene transfer LTG is the same as offspring inheriting genes from parents Corre this statement

Biology
The Living WorldChoose the correct order of events for the formation of the solar system Not all steps a listed collapse of nebular cloud into disk formation of proto sun accretion of planets O formation of proto sun collapse of nebular cloud into disk accretion of planets O accretion of planets collapse of nebular cloud into disk formation of proto sun

Biology
The Living WorldWhen the earth first formed within a 100 million years of accretion conditions may have supported life although we have no fossil evidence True False

Biology
Ecology - GeneralChoose the correct sequence of events in the evolution of the cell Not all steps are included O self replicating RNA RNA in protenoid spherules DNA replaces RNA O self replicating DNA DNA in protenoid spherules RNA replaces DNA O self replicating RNA DNA replaces RNA DNA in protenoid spherules

Biology
Ecology - EcosystemsThe oldest known fossils on earth are Ostromatolites Obrown algae O sharks O fungus

Biology
Ecology - Organisms & Population1 Use the information found in module three to help you complete this assignment Inform asked to read the lecture video or the links that are provided in the question There is no time limit and you have two attempts You score is the average of the two attem 2 1 point Molecules that contain a carbon based backbone are likely organic False O True 1 point


Biology
Ecology - GeneralWalter Cannon Per Scholander Knut Schmidt Neilsen George Somero Question 3 1 p If a scientist was interested in how nitrogen was extracted and sequestered within species their research would be classified as dar physiology