Biology Questions

The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.
Match the explanation for the origins of fossils with the correct description neoplatonism organic origin scala naturae fossils are part of a natural fix the vis plastica force shapes f v fossils are the remains of
Biology
Biological Classification
Match the explanation for the origins of fossils with the correct description neoplatonism organic origin scala naturae fossils are part of a natural fix the vis plastica force shapes f v fossils are the remains of
CASE STUDY You work in a busy nursing center Today you are responsible for caring for 12 residents You have been able to keep up with all of your duties however the nurse is running behind on her day s task She has requested you to deliver Miss Jones s medications to her Miss Jones is alert and oriented She knows what medications she takes and is able to swallow them without difficulties 2 How do you respond to the nurse delegating this task to you 3 Do you need to report the nurse s request to anyone Explain 1 Is this a task within your role Explain les delivering Miss Jone s presicatia s is within my role Foll handle administration important to ensure
Biology
Ecology - General
CASE STUDY You work in a busy nursing center Today you are responsible for caring for 12 residents You have been able to keep up with all of your duties however the nurse is running behind on her day s task She has requested you to deliver Miss Jones s medications to her Miss Jones is alert and oriented She knows what medications she takes and is able to swallow them without difficulties 2 How do you respond to the nurse delegating this task to you 3 Do you need to report the nurse s request to anyone Explain 1 Is this a task within your role Explain les delivering Miss Jone s presicatia s is within my role Foll handle administration important to ensure
From the choices select three criteria used to define life in general responds to stimuli maintains homeostasis occupies space reproduces
Biology
Cell: The Unit of Life
From the choices select three criteria used to define life in general responds to stimuli maintains homeostasis occupies space reproduces
Match the species definition to the correct description biological morphological genetic the genotypes are similar mating pairs can produce viab the phenotypes look the same
Biology
Ecology - Ecosystems
Match the species definition to the correct description biological morphological genetic the genotypes are similar mating pairs can produce viab the phenotypes look the same
The phenotype of an organism is the genetic information stored in the DNA O True O False
Biology
Molecular Basis of Inheritance
The phenotype of an organism is the genetic information stored in the DNA O True O False
Which type of species definition is best suited for recognizing microbial species Why Edit View Incert
Biology
Ecology - Ecosystems
Which type of species definition is best suited for recognizing microbial species Why Edit View Incert
Draw a simple cell Label the drawing with respect to the following features Save as a graphic or take a photo Upload the file a nucleus or nucleoid b location of DNA c location of ribosomal RNA d cytoplasm e cell wall membrane f location of genes
Biology
Ecology - Ecosystems
Draw a simple cell Label the drawing with respect to the following features Save as a graphic or take a photo Upload the file a nucleus or nucleoid b location of DNA c location of ribosomal RNA d cytoplasm e cell wall membrane f location of genes
A gene is O a building block of RNA O segment of DNA coding for a specific protein an RNA molecule a building block of DNA
Biology
Molecular Basis of Inheritance
A gene is O a building block of RNA O segment of DNA coding for a specific protein an RNA molecule a building block of DNA
Select the choice that describes the correct sequence of events in protein synthesis ORNA DNA protein Oprotein RNA DNA protein DNA RNA DNA RNA protein
Biology
Biomolecules
Select the choice that describes the correct sequence of events in protein synthesis ORNA DNA protein Oprotein RNA DNA protein DNA RNA DNA RNA protein
From the choices select three criteria used to define life in general maintains homeostasis reproduces occupies space responds to stimuli
Biology
The Living World
From the choices select three criteria used to define life in general maintains homeostasis reproduces occupies space responds to stimuli
EX A group of students tested to see if the acidity of water affected pea plant growth They followed a logical method and performed their experiment once using controls and experimental groups Their results supported their hypothesis Experiment 2 A group of students tested to see if bacteria growth in water was affected by acidity They used controls and experimental groups They repeated their experiment several times and found the results were the same Which experiment most likely has greater reliability and why
Biology
The Living World
EX A group of students tested to see if the acidity of water affected pea plant growth They followed a logical method and performed their experiment once using controls and experimental groups Their results supported their hypothesis Experiment 2 A group of students tested to see if bacteria growth in water was affected by acidity They used controls and experimental groups They repeated their experiment several times and found the results were the same Which experiment most likely has greater reliability and why
Experiment 1 A group of students tested to see if the acidity of water affected pea plant growth They followed a logical method and performed their experiment once using controls and experimental groups Their results supported their hypothesis Experiment 2 A group of students tested to see if bacteria growth in water was affected by acidity They used controls and experimental groups They repeated their experiment several times and found the results were the same Which experiment most likely has greater reliability and why
Biology
Strategies for Enhancement in Food Production
Experiment 1 A group of students tested to see if the acidity of water affected pea plant growth They followed a logical method and performed their experiment once using controls and experimental groups Their results supported their hypothesis Experiment 2 A group of students tested to see if bacteria growth in water was affected by acidity They used controls and experimental groups They repeated their experiment several times and found the results were the same Which experiment most likely has greater reliability and why
1 Hipofiz bezinin arka lobundan salg lanan antidi retik hormonun ADH az salg lanmas na ba l olarak I kan n ozmotik bas nc nda II doku sivisi miktar nda III idrar yo unlu unda meydana gelen de i imler a a dakiler den hangisinde do ru verilmi tir I A Artar B Azal r C Artar D Azal r E Azal r Azal r Azal r Azal r Artar Azal r Artar Azal r Azal r Artar Artar
Biology
Human Physiology - Neural Control & Coordination
1 Hipofiz bezinin arka lobundan salg lanan antidi retik hormonun ADH az salg lanmas na ba l olarak I kan n ozmotik bas nc nda II doku sivisi miktar nda III idrar yo unlu unda meydana gelen de i imler a a dakiler den hangisinde do ru verilmi tir I A Artar B Azal r C Artar D Azal r E Azal r Azal r Azal r Azal r Artar Azal r Artar Azal r Azal r Artar Artar
what is love
Biology
The Living World
what is love
4 The pediatric resuscitation team has been performing CPR on a child in cardiac arrest for 46 minutes One team member asks the team leader whether attempts should continue Which of the following factors will the team leader consider when using clinical judgment to decide whether to terminate the resuscitation effort Select all correct options that apply How much time elapsed before CPR was initiated and the first defibrillation was provided The patient s health status before cardiac arrest An ETCO level less than 10 mmHg after 20 minutes of high quality CPR The child is over 1 year but less than 10 years of age The compressor is fatigued
Biology
Human Physiology - General
4 The pediatric resuscitation team has been performing CPR on a child in cardiac arrest for 46 minutes One team member asks the team leader whether attempts should continue Which of the following factors will the team leader consider when using clinical judgment to decide whether to terminate the resuscitation effort Select all correct options that apply How much time elapsed before CPR was initiated and the first defibrillation was provided The patient s health status before cardiac arrest An ETCO level less than 10 mmHg after 20 minutes of high quality CPR The child is over 1 year but less than 10 years of age The compressor is fatigued
Answer the following prompt in a three sentence paragraph Which faction was the best when it came to both exploration and expansion 15
Biology
Ecology - General
Answer the following prompt in a three sentence paragraph Which faction was the best when it came to both exploration and expansion 15
psiho
Biology
The Living World
psiho
SA Generics have the same active ingredients as the brand name Generics offer savings to patients over the brand name product Generics are the trade names of each drug Question 11 From the following list of persons who is NOT authorized to prescribe medications Podiatrist Dentist O Registered nurse Osteopath Question 12 Which of the following is TRUE about C IV medications
Biology
Human Health and Diseases
SA Generics have the same active ingredients as the brand name Generics offer savings to patients over the brand name product Generics are the trade names of each drug Question 11 From the following list of persons who is NOT authorized to prescribe medications Podiatrist Dentist O Registered nurse Osteopath Question 12 Which of the following is TRUE about C IV medications
Now that you ve learned about the requirements of a personal narrative essay it s time for you to write your own Remember that a personal narrative should focus on the feelings memories and experiences of the author you and should tell a story about the author s life Your final draft should contain between 750 and 2 500 word You should not write about a longer time frame For example instead of writing about why owning a pet is memorable focus only on the day you brought your new pet home For the topic Explain why a certain sport is your favorite you must focus only on what makes the sport your favorite You should not include general information rules or history of the sport without including why the items make the sport your favorite For the topic Explain why a certain sport is your favorite you must select an activity that involves physical exertion and skill Activities such as reading
Biology
The Living World
Now that you ve learned about the requirements of a personal narrative essay it s time for you to write your own Remember that a personal narrative should focus on the feelings memories and experiences of the author you and should tell a story about the author s life Your final draft should contain between 750 and 2 500 word You should not write about a longer time frame For example instead of writing about why owning a pet is memorable focus only on the day you brought your new pet home For the topic Explain why a certain sport is your favorite you must focus only on what makes the sport your favorite You should not include general information rules or history of the sport without including why the items make the sport your favorite For the topic Explain why a certain sport is your favorite you must select an activity that involves physical exertion and skill Activities such as reading
We know that one large category of American commercials are those that try to convince you to choose particular medications For this Ulcers and Antacid assignment you are going to design a commercial for a made up antacid of your design and explain how your medication will alleviate symptoms and prevent the creation of ulcers For this you ll first need to research what these things are and what they do Directions 1 What is an ulcer is and how it is created 2 What symptoms do ulcers cause and how they can be treated 3 What antacids are and how do they work in general 4 How can antacids be used to treat ulcers 5 Design a fake antacid that you are going to be selling or convincing people to buy 6 What props and diagrams make some if necessary can help you explain the commercial
Biology
Human Physiology - Digestion
We know that one large category of American commercials are those that try to convince you to choose particular medications For this Ulcers and Antacid assignment you are going to design a commercial for a made up antacid of your design and explain how your medication will alleviate symptoms and prevent the creation of ulcers For this you ll first need to research what these things are and what they do Directions 1 What is an ulcer is and how it is created 2 What symptoms do ulcers cause and how they can be treated 3 What antacids are and how do they work in general 4 How can antacids be used to treat ulcers 5 Design a fake antacid that you are going to be selling or convincing people to buy 6 What props and diagrams make some if necessary can help you explain the commercial
a How does the process of cellular respiration compare with the process of photosynthesis The process of cellvor respiration occurd in Juitochon chic gluat AID Phodyen the si s guves places in Choled traPlast using light energ so convert Han clactose Both Procod s invarve energy arenormation
Biology
Plant Physiology - Photosynthesis
a How does the process of cellular respiration compare with the process of photosynthesis The process of cellvor respiration occurd in Juitochon chic gluat AID Phodyen the si s guves places in Choled traPlast using light energ so convert Han clactose Both Procod s invarve energy arenormation
What factors limit the rate of photosynthesis Why
Biology
Plant Physiology - Photosynthesis
What factors limit the rate of photosynthesis Why
21 For each label the structure and state its individual function B D AIRWAY E 90 urime Imm Bodo oodat Tuv vee A aerrein C
Biology
Human Physiology - Breathing & Exchange of Gases
21 For each label the structure and state its individual function B D AIRWAY E 90 urime Imm Bodo oodat Tuv vee A aerrein C
capillary V II I III
Biology
Human Physiology - Circulatory System
capillary V II I III
Explain how these structures model an alveolus Red and blue paper Balloon O Straw
Biology
Ecology - General
Explain how these structures model an alveolus Red and blue paper Balloon O Straw
When homologous chromosomes fail to separate during meiosis occurs Your answer 1
Biology
Principles of Inheritance & Variation (Genetics)
When homologous chromosomes fail to separate during meiosis occurs Your answer 1
The offspring of two different true breeding plants that differ in only one characteristic is called Your answer is a portion of a DNA molecule that carries the information that helps to produce a particular trait of an organism A Your answer A n remains attached to the original chromosome at the centromere 1 point 1 point is the identical copy of a single chromosome that 1 point
Biology
Principles of Inheritance & Variation (Genetics)
The offspring of two different true breeding plants that differ in only one characteristic is called Your answer is a portion of a DNA molecule that carries the information that helps to produce a particular trait of an organism A Your answer A n remains attached to the original chromosome at the centromere 1 point 1 point is the identical copy of a single chromosome that 1 point
Asexual reproduction is the production of offspring from the fusion of two sex cells O True O False Genotype refers to an individual s outward appearance with respect to a specific characteristic True False 1 point 1 point
Biology
Cell Cycle and Cell Division
Asexual reproduction is the production of offspring from the fusion of two sex cells O True O False Genotype refers to an individual s outward appearance with respect to a specific characteristic True False 1 point 1 point
Trisomy is a chromosomal abnormality in which there is a single chromosome in place of a homologous pair O True O False Sexual reproduction is the production of offspring from a single parent O True False 1 point 1 point
Biology
Cell Cycle and Cell Division
Trisomy is a chromosomal abnormality in which there is a single chromosome in place of a homologous pair O True O False Sexual reproduction is the production of offspring from a single parent O True False 1 point 1 point
A monohybrid cross is a cross designed to study the inheritance of only one 1 point trait O True O False A zygote is a pair of homologous chromosomes each with two sister chromatids O True False 1 point
Biology
Cell Cycle and Cell Division
A monohybrid cross is a cross designed to study the inheritance of only one 1 point trait O True O False A zygote is a pair of homologous chromosomes each with two sister chromatids O True False 1 point
An organism in which the genetic material has been altered using genetic engineering techniques is called a genetically modified organism O True O False Meiosis involves two divisions that produce four diploid cells O True False 1 point 1 point
Biology
Cell Cycle and Cell Division
An organism in which the genetic material has been altered using genetic engineering techniques is called a genetically modified organism O True O False Meiosis involves two divisions that produce four diploid cells O True False 1 point 1 point
During anaphase I of meiosis the tetrads migrate toward the center of the 1 point cell and align their centromeres across the middle of the cell True False Cloning is the process of producing one individual that is genetically identical to another using a single cell or tissue True False 1 point
Biology
Cell Cycle and Cell Division
During anaphase I of meiosis the tetrads migrate toward the center of the 1 point cell and align their centromeres across the middle of the cell True False Cloning is the process of producing one individual that is genetically identical to another using a single cell or tissue True False 1 point
Deoxyribonucleic acid is a molecule that carries genetic information in cells True False Cytokinesis is the portion of the cell cycle between mitotic divisions when the genetic material is duplicated True False 1 point 1 point
Biology
Principles of Inheritance & Variation (Genetics)
Deoxyribonucleic acid is a molecule that carries genetic information in cells True False Cytokinesis is the portion of the cell cycle between mitotic divisions when the genetic material is duplicated True False 1 point 1 point
Interphase is the process in which a eukaryotic cell divides its cytoplasm into two new daughter cells True False
Biology
Cell Cycle and Cell Division
Interphase is the process in which a eukaryotic cell divides its cytoplasm into two new daughter cells True False
An allele that if present is always expressed is called a recessive allele O True False
Biology
Biotechnology: Principles and Processes
An allele that if present is always expressed is called a recessive allele O True False
Two heterozygous purple flowered yellow seed plants are crossed Which 1 po of the following has the greatest probability of being produced a plant with white flowers and yellow seeds a plant with purple flowers and green seeds plant with white flowers and green seeds a plant with purple flowers and yellow seeds
Biology
Biotechnology: Principles and Processes
Two heterozygous purple flowered yellow seed plants are crossed Which 1 po of the following has the greatest probability of being produced a plant with white flowers and yellow seeds a plant with purple flowers and green seeds plant with white flowers and green seeds a plant with purple flowers and yellow seeds
Which non disjunction disorder does the individual with this karyotype have XXXK 3 2 5 Y 8 9 10 12 115 14 13 15 16 17 11 41 1 19 20 21 22 X Patau syndrome 6 b Down syndrome c Turner syndrome Od Edwards syndrome Ir 18 1 poin
Biology
Principles of Inheritance & Variation (Genetics)
Which non disjunction disorder does the individual with this karyotype have XXXK 3 2 5 Y 8 9 10 12 115 14 13 15 16 17 11 41 1 19 20 21 22 X Patau syndrome 6 b Down syndrome c Turner syndrome Od Edwards syndrome Ir 18 1 poin
Which chromosome abnormality does this karyotype show XXXK Y 8 9 10 11 SC Ir J 7 13 18 14 15 16 11 19 20 21 1 22 5 11 12 Otrisomy of chromosome 21 Otrisomy of chromosome 16 17 trisomy of chromosome 13 x monosomy of chromosome 13 6 SY
Biology
Biotechnology: Principles and Processes
Which chromosome abnormality does this karyotype show XXXK Y 8 9 10 11 SC Ir J 7 13 18 14 15 16 11 19 20 21 1 22 5 11 12 Otrisomy of chromosome 21 Otrisomy of chromosome 16 17 trisomy of chromosome 13 x monosomy of chromosome 13 6 SY
A parent that is RrPp can produce which gametes Rr RP Rp rP rp and Pp ORP and rp only Rr and Pp only RP Rp rP and rp
Biology
Molecular Basis of Inheritance
A parent that is RrPp can produce which gametes Rr RP Rp rP rp and Pp ORP and rp only Rr and Pp only RP Rp rP and rp
Which of the following is a possible cause of a mutation errors during cell division environmental agents chemicals all of the above
Biology
Biological Classification
Which of the following is a possible cause of a mutation errors during cell division environmental agents chemicals all of the above
Which statement is true regarding a dihybrid cross O A dihybrid cross has no relationship to a monohybrid cross O A dihybrid cross involves two genes and up to four alleles O A dihybrid cross involves two genes and exactly two alleles O A dihybrid cross is exactly the same as a monohybrid cross
Biology
Biotechnology: Principles and Processes
Which statement is true regarding a dihybrid cross O A dihybrid cross has no relationship to a monohybrid cross O A dihybrid cross involves two genes and up to four alleles O A dihybrid cross involves two genes and exactly two alleles O A dihybrid cross is exactly the same as a monohybrid cross
Which term refers to a chromosomal abnormality in which there are three homologous chromosomes in place of a homologous pair zygote trisomy monosomy tetrad
Biology
Biological Classification
Which term refers to a chromosomal abnormality in which there are three homologous chromosomes in place of a homologous pair zygote trisomy monosomy tetrad
Which term describes the passing of traits from parents to offspring O polyploid non disjunction locus heredity
Biology
Molecular Basis of Inheritance
Which term describes the passing of traits from parents to offspring O polyploid non disjunction locus heredity
k 1p Which term describes the failure of homologous chromosomes to move to opposite poles of the cell during meiosis O fragmentation O nondisjunction crossing over cytokinesis
Biology
Animal Kingdom
k 1p Which term describes the failure of homologous chromosomes to move to opposite poles of the cell during meiosis O fragmentation O nondisjunction crossing over cytokinesis
Matching Match each figure to the correct phase of meiosis Answer choices may be used only once a anaphase I b anaphase II c metaphase I d metaphase II e prophase I f prophase II g telophase I h telophase II and cytokinesis 1 CO 3 XX 4 AMMAD Za TA 5
Biology
Cell Cycle and Cell Division
Matching Match each figure to the correct phase of meiosis Answer choices may be used only once a anaphase I b anaphase II c metaphase I d metaphase II e prophase I f prophase II g telophase I h telophase II and cytokinesis 1 CO 3 XX 4 AMMAD Za TA 5
X 4 In order for photosynthesis to occur carbon dioxide from the atmosphere has to enter a leaf on the plant Which shows the correct pathway that the CO2 molecules would take lower epidermis to cuticle to spongy layer Opalisade layer to vein to stomata lower epidermis to spongy layer to palisade layer upper epidermis to spongy layer to palisade layer
Biology
Biotechnology: Principles and Processes
X 4 In order for photosynthesis to occur carbon dioxide from the atmosphere has to enter a leaf on the plant Which shows the correct pathway that the CO2 molecules would take lower epidermis to cuticle to spongy layer Opalisade layer to vein to stomata lower epidermis to spongy layer to palisade layer upper epidermis to spongy layer to palisade layer
No GFP 100 25 10 4 2 Counts Counts Counts Counts 50 100 0 10 Counts 50 0 10 100 50 100 0 10 10 50 10 100 10 0 10 10 50 0 1 10 GFP 87 77 10 GFP 10 10 GFP 82 83 10 104 10 104 81 21 104 10 10 GFP 73 13 104 0 10 10 10 10 104 GFP Figure S11 Transfection Efficiency of the PLAT E Cells and pMX System We transfected the GFP expressing retroviral vector and the control vector at ratios of 1 0 1 3 1 9 and 1 23 into MEFs with a constant amount of total DNA Forty eight hours later cells were photographed under a fluorescence microscope and analyzed by flow cytometry Bars indicate 200 m The analysis showed that 88 83 81 and 73 of transfected cells expressed GFP the mean GFP fluorescence being weaker with decreased concentration of the GFP expressing vector This indicates that 47 0 83 12 0 81 and 0 05 0 7324 of cells transfected with the four 10 or 24 factors expressed all the factors respectively In a 100 mm dish we plated 8 x 105 cells of which 4 x 10 cells should express all the four selected
Biology
Biotechnology & its Applications
No GFP 100 25 10 4 2 Counts Counts Counts Counts 50 100 0 10 Counts 50 0 10 100 50 100 0 10 10 50 10 100 10 0 10 10 50 0 1 10 GFP 87 77 10 GFP 10 10 GFP 82 83 10 104 10 104 81 21 104 10 10 GFP 73 13 104 0 10 10 10 10 104 GFP Figure S11 Transfection Efficiency of the PLAT E Cells and pMX System We transfected the GFP expressing retroviral vector and the control vector at ratios of 1 0 1 3 1 9 and 1 23 into MEFs with a constant amount of total DNA Forty eight hours later cells were photographed under a fluorescence microscope and analyzed by flow cytometry Bars indicate 200 m The analysis showed that 88 83 81 and 73 of transfected cells expressed GFP the mean GFP fluorescence being weaker with decreased concentration of the GFP expressing vector This indicates that 47 0 83 12 0 81 and 0 05 0 7324 of cells transfected with the four 10 or 24 factors expressed all the factors respectively In a 100 mm dish we plated 8 x 105 cells of which 4 x 10 cells should express all the four selected
27 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCACACUAGUUGC 3 Translate this sequence What type of mutation is this I
Biology
Molecular Basis of Inheritance
27 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCACACUAGUUGC 3 Translate this sequence What type of mutation is this I