Biology Questions

Which term describes the passing of traits from parents to offspring O polyploid non disjunction locus heredity

k 1p Which term describes the failure of homologous chromosomes to move to opposite poles of the cell during meiosis O fragmentation O nondisjunction crossing over cytokinesis

Matching Match each figure to the correct phase of meiosis Answer choices may be used only once a anaphase I b anaphase II c metaphase I d metaphase II e prophase I f prophase II g telophase I h telophase II and cytokinesis 1 CO 3 XX 4 AMMAD Za TA 5

X 4 In order for photosynthesis to occur carbon dioxide from the atmosphere has to enter a leaf on the plant Which shows the correct pathway that the CO2 molecules would take lower epidermis to cuticle to spongy layer Opalisade layer to vein to stomata lower epidermis to spongy layer to palisade layer upper epidermis to spongy layer to palisade layer

No GFP 100 25 10 4 2 Counts Counts Counts Counts 50 100 0 10 Counts 50 0 10 100 50 100 0 10 10 50 10 100 10 0 10 10 50 0 1 10 GFP 87 77 10 GFP 10 10 GFP 82 83 10 104 10 104 81 21 104 10 10 GFP 73 13 104 0 10 10 10 10 104 GFP Figure S11 Transfection Efficiency of the PLAT E Cells and pMX System We transfected the GFP expressing retroviral vector and the control vector at ratios of 1 0 1 3 1 9 and 1 23 into MEFs with a constant amount of total DNA Forty eight hours later cells were photographed under a fluorescence microscope and analyzed by flow cytometry Bars indicate 200 m The analysis showed that 88 83 81 and 73 of transfected cells expressed GFP the mean GFP fluorescence being weaker with decreased concentration of the GFP expressing vector This indicates that 47 0 83 12 0 81 and 0 05 0 7324 of cells transfected with the four 10 or 24 factors expressed all the factors respectively In a 100 mm dish we plated 8 x 105 cells of which 4 x 10 cells should express all the four selected

27 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCACACUAGUUGC 3 Translate this sequence What type of mutation is this I

0 21 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGGCCCGCACAAUAGUUGC 3 Translate this sequence What type of mutation is this

10 Eye color red or white in the fly Drosophila is determined by the X chromosome The dominant version of the allele XR causes red eyes while the recessive allele causes white eyes X Females can have red eyes XRXR XRX or white eyes X X Males only receive one copy of the X chromosome so whatever allele version they receive determines their eye color If a white eyed male is crossed with a red eyed heterozygous female what will the phenotypic ratios of the offspring be

Which of the following questions can be asked about organisms that live in fresh water Will their bodies take in too much water Can they control their tonicity Can they survive in salt water Will their bodies lose too much water to their environment 12 Which of the following explains why active movement of molecules across membranes must function continuously 13 Why must active transport of molecules across plasma membranes function continuously Diffusion cannot occur in certain cells Diffusion is constantly moving solutes in opposite directions Facilitated diffusion works in the same direction as active transport Not all membranes are amphiphilic 14 How does the sodium potassium pump make the interior of the cell negatively charged by expelling anions by pulling in anions by expelling more cations than it takes in by taking in and expelling an equal number of cations 15 What is the difference between primary and secondary active transport Primary active transport is indirectly dependent on ATP while secondary active transport is directly dependent on ATP Primary active transport is directly dependent on ATP while secondary active transport is indirectly dependent on ATP Primary active transport does not require ATP while secondary active transport is indirectly dependent on ATP Primary active transport is indirectly dependent on ATP while secondary active transport does not require ATP 16 What happens to the membrane of a vesicle after exocytosis It leaves the cell It is disassembled by the cell

7 Identify the principal driving movement in diffusion such as Extracellular fluid Lipid bilayer plasma membrane Time depicted here concentration gradient membrane surface area particle size temperature O Cytoplasm 0 00 8 Which of the following is an example of passive transport across a membrane the movement of text H into a thylakoid disc during photosynthesis the uptake of glucose in the intestine the uptake of mineral ions into root hair cells of plants the movement of water from the descending loop of a nephron into the interstitium 9 Water moves via osmosis across plasma cell membranes in which direction from an area with a high concentration of other solutes to a lower one from an area with a high concentration of water to one of lower concentration from an area with a low concentration of water to one of higher concentration throughout the cytoplasm 10 What problem is faced by organisms that live in fresh water They will have higher concentrations of body solutes Without compensating mechanisms their bodies tend to take in too much water They have no way of controlling their tonicity

Unit Chemical Writing Formula Equations WS 1 Directions Convert the following word equations into formula equations by changing element and compound names into chemical formulas 1 sodium oxygen sodium oxide 2 copper silver nitrate copper II nitrate silver 3 aluminum chlorate barium sulfate aluminum sulfate barium chlorate 4 bromine calcium iodide calcium bromide iodine 5 zinc sulfide magnesium arsenate zinc arsenate magnesium sulfide 6 cobalt lead II nitrite cobalt III nitrite lead muptorpotassium hydroxide hydrogen qmsx3

How would an organism maintain membrane fluidity in an environment where temperatures fluctuated from very high to very low Greater proportion of unsaturated phospholipids in membranes Greater proportion of saturated phospholipids in membranes Greater proportion of carbohydrates in membranes Greater proportion of proteins in membranes 5 According to the fluid mosaic model of the plasma cell membrane what is the location of carbohydrates in the cell membranes Carbohydrates are in contact with the aqueous fluid both inside and outside the cell Carbohydrates are present only on the interior surface of a membrane Carbohydrates are present only on the exterior surface of a membrane Carbohydates span only the interior of a membrane 6 What do double bonds in phospholipid fatty acid tails contribute Hydrophilic head Hydrophobic tails 0 P 0 5 0 R OL O O CH CH CH O CIO CO Saturated fatty acid Unsaturated fatty acid to the fluidity of membranes the hydrophobic nature of membranes Phosphate Glycerol

1 Which plasma membrane component can be either found on its surface or embedded in the membrane structure carbohydrates cholesterol glycolipid protein 2 In addition to a plasma membrane a eukaryotic cell has organelles such as mitochondria that also have membranes In which way would these membranes differ The proportion of phosphate within the phospholipids will vary Only certain membranes contain phospholipids Only certain membranes are selectively permeable The proportions of proteins lipids and carbohydrates will vary 3 Which characteristic of a phospholipid shown here increases the fluidity of the membrane Hydrophilic head Hydrophobic tails O P CH CH O O 0 CH CO CO H Saturated fatty acid Unsaturated fatty acid Phosphate Glycerol

Directions Balance the following equations Nal F2 NaF 1 2 3 4 S Pb ClO2 4 Li OH Reactions Balancing Equations WS 2 Cr N 1500 Zn SO4 Li O Ca3N2 2 H O Cr203 12 Pb SO4 2 Zn ClO2 2

Discuss the characteristics of each of the following biomes to include soil type annual rainfall mean temperature and biotic features Chaparral savanna taiga temperate forest temperate grassland tropical rain forest tundra

Discuss ecological succession and compare the effects of primary succession versus secondary succession

Discuss species diversity Give an example of what can happen when agricultural diversity is ignored

Describe the mechanisms by which human population growth and resource use causes increased extinction rates

4 Ionic compounds In the chart below write the ionic formula if it gives you the ionic compound name Write the ionic compound name if it gives you the formula lonic Compound Name Iron III chloride Ammonium phosphate Tin IV sulfate Potassium perchlorate Aluminum hydroxide Sodium chloride Calcium fluoride Potassium bromide Magnesium carbonate Formula lonic Compound Name Formula NaF Bel2 Al2O3 FeF3 PbO CaSO3 Ba3 PO4 2 NH4 2CO2 Cul2

What is true about the semiconservative model of DNA replication occurs through the addition of nucleotides to the end of the parental DNA molecule results in the formation of four new DNA strands uses each strand of a DNA molecule as a template for the creation of a new strand begins when two DNA molecules join together to exchange segments

Study guide The following are the topics you need to know and understand These are the areas that will be covered on the exam 1 List the steps of the scientific method in order Observation Question Hypothesis Experiment Anaysis conclusion 2 Write down an example of an experiment and write out a hypothesis independent variable and dependent variable 3 Compare Sand silt and clay soil separation lab properties Tra Use a soil triangle to find out the names of the following soil compositions a 30 sand b 25 sand 45 silt 30 clay 30 silt 40 clay 5 Write the charges of each of the following subatomic particles a Proton b Neutron c Electron 6 Structure of an atom Draw an atom below and put in electrons protons and neutrons in their correct place in the atom

14 Significant figures and scientific notation a How many significant figures are in the following i 5004 ii iii iv V 0 00984 20 000 3 000546 15849 b Write the following numbers using scientific notation i 4 230 000 ii 0 0000000543 iii 26 300 000 000 c Convert the following scientific notation into standard notation i 4 6 X 104 ii 7 86 X 10 6 iii 5 2 X 1012

7 Know how to use a periodic table What is a period What is a group Trends in the elements on the table 8 What is an atomic number atomic mass 9 When is an atom most stable 10 How to calculate the number of neutrons in an atom 11 Metric system conversions a How many L in 53ml b How many cg in 2500 mg c How many Km in 3000 m 12 Use dimensional analysis to calculate metric conversions a How many grams are in 563 mg b How many centimeters are in 432mm c How many kiloliters are in 72 ml 13 Draw the Lewis dot diagrams and Bohr models for a Potassium C Lithium b Magnesium d Calcium

What technique is used to find out where a protein or RNA is expressed cell culture DNA sequencing polymeraze chain reaction immunofluorescence

Gene therapy detailed information about the structure organization and function of the complete set of human genes the process of determining the precise order of nucleotides within a DNA molecule aims to treat a disease by replacing mutated or defective gene with a functional allele process of cultivating cells and tissues outside the body of an organism in vitro in an artificial

The genetic code is unambiguous nearly universal redundant All of the above

The following are needed for translation to occur EXCEPT Ribosomes transfer RNA messenger RNA RNA polymerase

O Used to study the expression of interacting groups of genes Used to detect the presence of proteins in tissue detailed information about the structure organization and function of the complete set of hu genes the process of determining the precise order of nucleotides within a DNA molecule

The following mechanisms are levels at which gene expression can be regulated EXCEPT Transcription Translation RNA processing None of the above

DNA replication requires which of the following DNA polymerase and helicase RNA polymerase and helicase Ribosomes and RNA Transcription factors

Match term with description Cell culture Used to study the expression of interacting groups of genes Used to detect the presence of proteins in tissue the process of determining the precise order of nucleotides within a DNA molecule process of cultivating cells and tissues outside the body of an organism in vitro in an a environment

Which of the following best depicts the flow of information of gene expression RNA DNA protein DNA RNA protein protein RNA DNA RNA DNA protein

Used to study the expression of interacting groups of genes Used to detect the presence of proteins in tissue detailed information about the structure organization and function of the complete set of hum genes the process of determining the precise order of nucleotides within a DNA molecule

RNA PROCESSING involves which of the following A addition of a nucleotide 5 cap to the molecule B addition of a poly A tail to the molecule C RNA splicing D A and B only E A B and C

Match the term with their decription promoter DNA packing and methylation Telomeres Polymerase chair reaction PCR Choose DNA packing and methylation Control sequence where RNA polymerase attaches and initiates transcription B Sequences at the end of chromosomes that postpone the erosion of genes at the end of chromosomes and related to D Method to make millions of copies of DNA in vitro Choose Choose

What would happen if ribosomes DO NOT bind to mRNA nothing will happen Proteins will be translated Translation will not occur

Mistakes during DNA replication can cause mutations in the DNA can lead to which of the following A abnormal development B Cancer C There is no effect D A and B

Which of the following statements best summarizes the structural differences between DNA and RNA A RNA is a double helix but DNA is single stranded B DNA is double stranded and RNA is single stranded C DNA nucleotides contain deoxyribose sugar and RNA a ribose D B and C are correct

Muscle cells and nerve cells in one species of animal owe their differences in structure to having different chromosomes using different genetic codes having different genes expressed having unique ribosomes

Which of the following statements is true about base paring in DNA Guanine G binds to Adenine A whereas Thymine binds to Cytosine C Adenine binds to Thymine T wheras Guanine binds to Cytosine C

Females need of a recessive sex linked gene to express the recessive phenotype one copy two copies throo conic

Duchene s syndrome color blindness and hemophilia are examples of disorders caused by a recessive sex linked gene dominant autosomal disorder diet exposure to radiaation

a Explain how biotic and abiotic factors can impact growth of populations biotic Predation Competition for seagant bPotic Climate availibity of nutrients 01 b How does one feeding niche impact others in a community

7 Cecum lab what evidence can you use to identify which feeding niche an organism occupies a Explain the difference in digestive tracts between herbivores omnivores carnivores

13 Tusklessness Explain how humans can be a selective pressure that changes animal populations

11 Food web food chain explain how human activities can affect a food web or food chain

18 Cell respiration why must cells undergo the process of cellular respiration a How does the process of cellular respiration compare with the process of photosynthesis b Which organisms complete photosynthesis c Why is photosynthesis important for these organisms d Which organisms complete cellular respiration e Why is it an important reaction

13 Tusklessness Explain how humans can be a selective pressure that changes animal populations

1 Food web food chain explain how human activities can affect a food web or food chain

7 Photosynthesis explain the products and reactants of photosynthesis a What factors limit the rate of photosynthesis Why b Why is oxygen a good indicator to determine if a plant is undergoing photosynthesis