Biology Questions
The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.

Biology
Microbes in Human WelfareThe O F test is selective for bacteria that conduct fermentation versus aerobic oxidative respiration 4 Facultative anaerobes such as members of the family Enterobacteriaceae are capable of both aerobic respiration and fermentation What color results would you expect for such organisms when grown in O F glucose media a The sealed media should turn yellow and the unsealed media should remain green b The sealed media should remain green and the unsealed media should turn yellow c The sealed tube should turn yellow and the unsealed tube should turn blue d Both the sealed and unsealed media should turn yellow e Both the sealed and unsealed tubes should remain green

Biology
Cell: The Unit of Life3 Mark each statement as true or false and correct the false statements so they read as true If a bacterium carries out oxidative metabolism it cannot also carry out fermentation O F media is designed to detect the alkaline byproducts of fermentation O F media provides a single carbohydrate source The O F test is selective for bacteria that conduct fermentation versus aerobic oxidative respiration 57

Biology
Anatomy of Flowering Plants2 Why is mineral oil added in the O F test a To serve as a nutrient source b To keep potential pathogens from becoming airborne c To remove oxygen from the media d To help oxygen diffuse through the media e To maintain an anaerobic environment

Biology
Cell: The Unit of Life1 Select the true statement s about O F media select all that apply a It is a differential medium b It is a selective medium c It contains methylene blue as a pH indicator d The test is inoculated in pairs so that the media can be sealed off from atmospheric oxygen in one case but not the e The media can differentiate between bacteria that use both oxidative and fermentation processes from those that o conduct fermentation

Biology
The Living World4 Students will write their genetic crosses and plans to generate a double mutant fly

Biology
BiomoleculesThe amino acid shown below is which of the following COO HN C H H C CH CH O tryptophan O proline O histidine O leucine arginine

Biology
Principles of Inheritance & Variation (Genetics)For this pre lab assignment you will submit a 1 page drawing that demonstrates the differences between Mendel s two main laws the law of segregation and the law of independent assortment in a 2N 4 cell on your drawing include a hypothetical gene A on one pair of chromosomes a dominant A allele on one chromosome and the recessive a allele on its homologous partner and a hypothetical gene B on the second pair of chromosomes a dominant B allele on one chromosome and the recessive b allele on its homologous partner Include a written description of the main differences between the two laws and explain how each law impacts the movement of the gene A and gene B alleles into gametes You can using a drawing program or you can hand draw

Biology
The Living World1 Students will write a short summary about how early body plan is established in Drosophila embryos minimum 300 words

Biology
Biological ClassificationWhat did genetic analysis of the two groups of North Atlantic killer whales show A B C D Based on genetics they remain the same species The two groups have already diverged into separate species Genetic analysis revealed that the two groups are converging into one species The analysis showed variations that indicate they are diverging

Biology
Biological ClassificationSelect all that apply The activities within a cell are similar to the transportation system of a city because Ocell organelle movement becomes clogged at times much like rush hour traffic slows specialized reactions are confined to certain areas of a cell just as specialized transportation systems like subways travel only along certain p the routes traveled by vehicles can be compared to reaction pathways in a cell transportation routes in a city operate simultaneously as do cell activities all molecules move from point A to point B like cars going down a one way street

Biology
Cell: The Unit of LifeRank the sequence of cross bridge cycling starting with the myosin binding sites being exposed and ending with relaxation due to cross bridge cycling ending Do not overlap any events View Available Hint s Calcium ion concentration decreases below the threshold for binding to troponin First event Calcium ions pumped into the sarcoplasmic reticulum Power stroke moves thin filament Cross bridges detach from actin Myosin head forms cross bridge with actin Myosin binding sites covered Myosin head is re energized Reset Help ATP attaches to myosin head Last event

Biology
Ecology - Biodiversity & Conservation31 Which of the following is a inverse PCR method A using primers with 1 bp change to generate mutations no B using primers with restriction enzyme sequences adapter on the 5 end using primers that sequence outwards to obtain upstream and downstream sequence none of the above D

Biology
Biotechnology: Principles and Processes7 You have designed primers for PCR Which of the following is incorrect A You should have poly AAAAAA at 3 end B The annealing temperature of both primers should be similar C High GC content D the annealing temperature is about 5 degree below Tm allo

Biology
Plant Physiology - Respiration5 Pyrophosphate is a A building block for DNA synthesis B by product of DNA synthesis C precursor to DNA synthesis D fire phosphate used in nucleic acid metabolism All of the above E

Biology
The Living WorldThe diagram below shows how DNA is sequenced Step 1 5 Step 2 ddCTP ddGTP ddTTP ddATP A T Step 3 STARSA Template strand 5 CGCA 3 Primer 3 GCGT 5 sequence known 5 T CGCA 3 3 AATGTGGGCTATICGGGCGT 5 5 TT CGCA 3 3 ATCTGGGCTATTCGGGCGT 5 Step 5 Step 6 3 Laser Step 4 Electrophoresis 3 A Longest A fragment PATCTGGGCTATICGG Detector G Shortest G fragment 5 3 AATCT GGGCT ATT CGG 5 Step 7 5 TTAGACCCGATAAGCCCGCA 3 babresa sortearE Soitin

Biology
The Living WorldSemiconservative replication of DNA involves A each of the original strands acting as a template for a new strand a B only one of the original strands acting as a template for a new strand C the complete separation of the original strands the synthesis of new strands an reassembly of double stranded molecules D the use of the original double stranded molecule as a template E None of the above The enzyme that unwinds the DNA prior to replication is called A DNA polymerase III D primase B DNA ligase E helicase C single stranded DNA binding protein DNA ligase A Keeps the two complementary strands of DNA separated B Untwists strands of DNA CD Links the 3 OH to the 5 PO4 forming the phosphodiester bridge D Processively adds a complementary nucleotide to the 3 end of a new strand o E Synthesizes short RNA primers 3 DNAiguae Por Lopping DNA gyrase 0 35 leading A Keeps the two complementary strands of DNA separated B Untwists strands of DNA C Links the 3 OH to the 5 PO4 forming the phosphodiester bridge D Processively adds a complementary nucleotide to the 3 end of a new strand

Biology
Biomolecules3 The florescent dye attached to ddNTPs in DNA sequencing A aids in visualization of the DNA strand when the ddNTP is incorporated and determine what base it is B acts as a catalyst for the reaction terminates the reaction aids in electrophoresis None of the above

Biology
Cell Cycle and Cell Division4 Semiconservative replication of DNA involves B each of the original strands acting as a template for a new strand us of 20 only one of the original strands acting as a template for a new strand the complete separation of the original strands the synthesis of new strands reassembly of double stranded molecules the use of the original double stranded molecule as a template None of the above D E STOR

Biology
Anatomy of Flowering PlantsA B 1 In what way does a ddNTP differ from its dNTP counterparts The ddNTP has an extra COOH group The ddNTP has an extra OH group The ddNTP is missing an OH group D The ddNTP is a doublet of the dNTP E The ddNTP is not attached to the base C

Biology
The Living WorldChemical synthesis of DNA Linking first nucleotide to column Removing oligonucleotide from column Purifying oligonucleotide Washing Detritylation Washing Activation and coupling 100 Washing Capping Oxidation n cycles What are the special nucleotide that used in this synthesis How is it different from regular nucleotide The direction of chemical synthesis What are on the platform column What would be the first nucleotide that linked to the platform column 5 GGATCGGAAT 3 How many bases are on the oligonucleotides after n cycles What technique is used to purify oligonucleotides Explain the following steps Detritylation Activation and Coupling Capping and Oxidation including washing after

Biology
Ecology - Biodiversity & ConservationPREDICTION 0 Atmosphere no 02 more CO2 Earliest 2 1 F Atmosphere more 02 less COZI ON B Haceral Cell Prokaryote Multicellutar Plant Energy Competition Chemoautotrophie Anaerobic Bacteria 3 Multicellular Animal Ocean of Molecules 12 AHME RNA 4 A 5 H C Cyanobacteria M sen 6 7 D GD H 1 Organic molecules N Prediction Provide a justification for your group s sequence of events HISTORY OF LIFE ON EARTH 8 H L E Unicellular Eukaryote 9 J Big Bang How did you know which cards to place first S the beginning BID bang What is the reason you placed the cards on the latest end Bis the latest beca 10 I 11 up you will first make a prediction about the sequence of events by placing the environment and organism cards along the timeline poster provided by the teacher Place earlier events on the left hand side of the timeline and later events on the right hand side Provide a justification for your choices in the space below 3 12 13 JE of the anivers e 14 Latest 15 F 3 Animal is Latest new to the world ar Which cards are you most uncertain about their placement everything comes First then s What questions do you now have

Biology
Biomolecules1 Calculate the population growth expected in a sample of E coli of 108 per ml in 10 ml of medium over 24 hours Hint use the Nert equation for population growth N Noe Where r 0 25 and 7 generations are expected over 24 hours

Biology
BiomoleculesName Serenity m Period 3 Directions For each of the following statements write true or false T or F 1 Carbon atoms can bond together in straight chains branched chains or rings 2 Large carbon based molecules composed of repeating subunits are commonly referred to as macromolecules E F 3 Polymers are formed by hydrolysis 4 Cells use carbohydrates for energy Directions Write each item below under the correct heading cellulose Sucrose Starch Monosaccharides 5 C6H12O6 6 Glucose 7 Pructose fructose glucose Disaccharide 8 lactose cellulare 9 Description 13 Form the structure that stores genetic information 14 Most consist of three fatty acids bonded to a glycerol molecule 15 DNA and RNA C6H O6 16 Commonly called fats and oils 17 Made up of amino acids 18 Used for long term energy storage insulation Lipids ON A Date 0 7 07 glycogen lactose 10 11 Polysaccharide starch 914209e 12Sucrose Proteins Nucleic Acids IDNA

Biology
The Living WorldPlants name Main plant Marigold Tagetes Other plants also included in lab Vinca Catharanthus roseus Begonia Level of soil per pot Pot 1 5 cm Pot 2 7 5 cm Pot 3 12 cm Pot 4 15 cm IV Level amount of soil in the different pots DV Amount of leaves on each branch of the plant within each pot Research Question How does the mass of soil affect the amount of leaves on each branch of a marigold plant Constant variables Watered evenly Same amount of sunlight Same location time span Directions Using the information above please write a few paragraphs answering the questions below in the format of an IB Biology IA Lab report Personal Significance Research question is based on authentic personal interest or curiosity Loignificance is not contrived for example I have always beer


Biology
Ecology - GeneralPhotosynthesis Making Energy Plate Call Chloropfent Chloroplasts Photosynthesis is a process in which sunlight energy is used to make glucose The site of photosynthesis is in the chloroplast an organelle found in the leaves of green plants The main functions of chloroplasts are to produce food glucose during photosynthesis and to store food Stena LAINWONE 1 What is photosynthesis www Over 2 Where does photosynthesis occur 3 What are chloroplasts and where are they found Stra Thysod energy Chloroplasts contain the pigment chlorophyll Chlorophyll absorbs most of the colors in the color spectrum and reflects only green and yellow wavelengths of light This is why we see leaves as green or yellow because these colors are reflected into our eyes 4 What are the two main functions of chloroplasts 5 Why do most leaves appear green What is the primary pigment found in the chloroplast wecare Space Gracem luch of Thylaciti


Biology
Ecology - Biodiversity & ConservationDNA Replication Labeling with word bank DNA polymerase 5 DNA Ligase Okazaki fragment DNA Primase Single Strand Binding Leading Strand Lagging Proteins Strand 5 3 Helicase RNA primer OTTY Mys Ox 3 5 Topoisomerase

Biology
Principles of Inheritance & Variation (Genetics)Enzyme that unwinds DNA Fragments of copied DNA created on the lagging strand The strand that is copied in a continuous way from the 3 to 5 direction Binds Okazaki fragments Builds a new DNA strand by adding complementary bases Stabilizes the DNA molecule during replication Strand that is copied discontinuously because it is traveling away from helicase Initiates the synthesis DNA by creating a short RNA

Biology
BiomoleculesPlace the events in the correct order DNA polymerase adds nucleotides in the 5 to 3 direction Replication fork is formed DNA polymerase attaches to the primer Okazaki fragments are bound together by ligase

Biology
Human Health and Diseasese 155 156 159 160 8 3 Describe a genotype and phenotype of a genetic carrier and use this term appropriately Drag each correct term to complete the passage Drag word s below to fill in the blank s in the passage Some genetic disorders are said to skip a generation but they are present in a parent known as a by another allele The only who has a copy of the allele for the disorder that is disorders that cannot be inherited in this way are in disorders that are only one parent the can pass on the disorder without expressing it


Biology
Biotechnology: Principles and ProcessesQuestion 1 0 25 p In the reaction 6CO2 6H 20 C 6H 120 6 60 2 which side should energy be placed on the right side this is an endergonic reaction neither side the reaction is in equilibrium O the right side this is an exergonic reaction the left side this is an exergonic reaction the left side this is an endergonic reaction

Biology
Human Physiology - Generalsubstance as an acentuar fuld an extracellular fluid a solute in body fluids or neither a body fluid nor a solute Drag the appropriate items to their respective bins View Available Hint s lymph Intracellular fluid interstitial fluid water soluble proteins Extracellular fluid plasma whole blood red blood cells Solute in body fluids glucose electrolytes Reset Neither fluid nor solute Help

Biology
The Living WorldWhat is the main difference between a hormone and a neurotransmitter Check all that apply ONeurotransmitters act rapidly and with short duration whereas hormones act more slowly and produce effects of longer duration A neurotransmitter transmits a chemical message from an endocrine gland to a target tissue A hormone carries an impulse between neighboring nerve cells A neurotransmitter carries an impulse between neighboring nerve cells O A hormone transmits a chemical message from an endocrine gland to a target tissue Hormones act rapidly and with short duration whereas neurotransmitters act more slowly and produce effects of longer duration

Biology
Animal KingdomO fungi can digest rock and turn it into soil that allowed for the movement of plants to land Ofungi can photosynthesize Question 19 Which of the following were used as scientific evidence to support the idea that Prototaxites was a giant fungus and not a plant Select all that apply It produced relatively small amounts of pollen It had lopsided rings that were determined to be hyphae It was determined to have cell walls made of chitin 0 5 p It had carbon icet

Biology
Biological ClassificationIt was determined to have cell walls made of chitin It had carbon isotope ratios that were more similar to those found in fungi and animals than plants Question 20 How do fungi help plants live on land Select all that apply COD They help stabilize the roots in the soil They help the plants retain moisture They help the plants get and retain nitrogen They provide sugars via photosynthesis to the plant

Biology
The Living World0 Number of plants 30 25 20 5 0 a Wt An b VF Treatments NS Legend All plants were exposed to heat stress Wt wild type plants that have the normal fungal symbiont and the fungus has the normal viral infection An plants that originally did not have the fungal symbiont with the normal viral infection but it was added at the start of the experiment VF virus free plants in which the viral symbiont were removed from the fungus NS nonsymbiotic plants that had the fungal symbiont removed Chlorotic a condition in plants in which leaves produce insufficient chlorophyll NS Dead Chlorotic Healthy This graphic summarizes the results of a study looking at the role of a virus in the ability of the fungus Curvularia protuberata to confer heat tolerance in panic grass This virus normally infects C protuberata Which of the following statements best summarizes the results of this experiment O Plants that have C protuberata removed have greater heat tolerance than those that retain the fungus The presence of the virus reduces the fungus ability to confer heat tolerance on the plants The ability of the fungus to confer heat tolerance on the plants relies on a viral symbiont

Biology
Biological ClassificationIn the video the interviewer asks the scientist if he has concerns about infecting crop plants with fungi because some fur produce toxins What is the correct term to refer to fungal toxins Rusts Mildew Fungitoxins

Biology
The Living WorldAccording to the video why is it important to learn about these fungi 0 5 If we can prevent our crop plants from being infected with C protuberata we can increase crop yields Climate change has the potential to reduce crop production and the fungus ability to confer thermal tolerance may help us increase cre production Viral diseases are decreasing crop yields and this fungus can protect crop plants from viral infection

Biology
The Living WorldThe relationship between the fungus Curvularia protuberata and the panic grass found in Yellowstone is an example of a mutualism parasitism commensalism

Biology
BiomoleculesWhen Curvularia protuberata reproduce sexually they produce the structure seen above Based on this structure you can conclude that C protuberata is a member of the Basidiomycota Ascomycota Zygomycota Chytridiomycota

Biology
The Living WorldA African slope B European slope Melanin is a pigment protein that causes cells to become dark in color In fungi melanin is sometimes referred to as fungal armor because it protects fungal cells from a wide range of stressors Researchers in Israel s Evolution Canyon system studied the adaptive melanin response of the soil fungus Aspergillus niger to UV radiation UV radiation causes mutations in DNA Based on your knowledge of the Evolution Canyon system which of the following is a likely difference between populations of A niger found on the African slope AS and the European slope ES Mean melanin concentration is higher on the shady ES than on the sunny AS O Mean melanin concentration is higher on the sunny AS than on the shady ES O There is no reason to expect a difference in melanin concentration between the ES and AS populations

Biology
The Living WorldQuestion 7 Why does an ascus contain 8 ascospores following meiosis which usually results in the production of 4 genetically distin daughter cells The four haploid ascospores undergo an additional round of mitosis after meiosis is complete Meiosis in ascomycetes starts with karyogamy of four haploid nuclei The diploid nucleus undergoes mitosis

Biology
Biotechnology & its Applications2 The genome size of E coli K12 is approximately 4 6 x 106 base pairs with a mutation rate of 1x 10 9 per genome per generation how many mutations would you expect to appear in the population above after 24 hours 3 If the growth rate was r 0 1 how many mutations would you expect in this culture

Biology
Cell: The Unit of LifeIn the fungal life cycle if the number of chromosomes in a diploid nucleus is 10 which one of the following statements will be true The spores will also be diploid and have five chromosomes per cell Plasmogamy will produce a dikaryon with five chromosomes The spores will be tetraploid and have 20 chromosomes per cell The spores will be haploid and have five chromosomes per cell

Biology
The Living WorldWith the exception of flagellated spores for members of the Chytridiomycota fungi are mostly nonmotile What adap feature allows them to be such successful decomposers pathogens and symbionts even though they lack motile cells The production of large numbers of easily dispersed spores in sexual and asexual modes of reproduction They are diploid for most of their life cycle They have complex cellular specialization

Biology
Biomolecules1 What is the hormonal signal regulating the pathway shown in th figure 2 What s the difference between PFK 1 and PFK 2 3 How does PFK 2 regulate glycolysis 4 What s the role of CAMP

Biology
Cell: The Unit of LifeYou have discovered a new species of fungus associated with plant roots It invades the cells in the roots forming arbus mycorhizzae Based just upon this character you confidently determine that this fungus is member of the Ascomycota Basidiomycota Glomeromycota Zygomycoto

Biology
Biological ClassificationA Think about diffusion and osmosis what would happen in the potato experiment if the potatoes were incubated in the refrigerator instead of at room temperature Why B Diffusion is affected by the size of the molecule that is diffusing Think about the potato experiment Do you think the potato experiment would work differently if we used a different kind of solution We are using NaCl MW 58 44 g mol what if we used sucrose MW 342 3 g mol Why or why not C In lecture we described the process of osmosis as the diffusion of water through a semi permeable membrane from a region of low solute concentration to a region of higher solute concentration The manifestation of osmosis depends on which specific molecules a membrane allows movement to For example consider a setup as shown below In situation 1 the membrane dotted line allows movement of water ONLY In situation 2 the membrane allows passage of water and Na2 and C1 A B