Biology Questions

Myo and sarco are both prefixes related to muscle What vocabulary word is used for the endoplasmic reticulum of muscle cells myofibril sarcolemma sarcoplasm Jarmic reticulum

This Reading Assignment covers Modules 10 1 through 10 4 of the Question 1 A muscle cell is called a chondrocyte myocyte 1111

Can you please make one question about this topic regulation glycology and answer it in a paragraph in your own words

What technological challenges primarily prevent CRISPR I research on human embryos

Why is oxaloacetate an intermediate in the citric acid cycle and why is it regenerated

Which media is not considered a combination differential media a Urea broths b SIM medium c TSI slants d MIO medium Hey liso sitoed adi gord 226q of liema oc

7 What does the I mean in SIM a In b Indole c India d Invest

14 With the TSI agar an organism that does not ferment any of the carbohydrates but utilizes peptone and amino acids will alkalinize the medium and turn it a Red b Yellow 101 laitroza c Black d Green ybula adi

17 Effective hand washing maximizes direct person to person transmission of pathogens a True b False boy amus sibam ould amur ibom Mie iniq amut sibsra let

11696 127 ml 916 2536hvduche 997 farlW EI 18 Which type of UV has the shortest wavelength being seotui scopul is a UVA Scopulg 920 920102 d 520002 970tlsm 92016 3 misleg s uliem gaopulo b b UVB c UVC d UVZ to yns inemist jon 29ob jeni mai ne 096 121 gruHWA

16 Products with bacteriostatic agents a kill b stops growth of the microbes

13 What three carbohydrates are in TSI agar a Glucose fructose galactose molsvew 129710da sitt cn VU To b Sucrose lactose glucose c Lactose maltose sucrose d Glucose maltose galactose appli

15 Differentiate between the zone of inhibition and antibiotic susceptibility

12 How can you tell if an organism is H S positive a SIM media turns red b SIM media turns black c TSI media turns pink d TSI media turns blue mixam

bacteria rec mydrogen s production of ferrous with H S black pre the SIM a positive that indi result is results 10 With which agar can you observe gas in the butt of the tube a MIO b SIM C TSI d Urea sidiary on 26W 850 10 svifizoq saidt al bsau 11 Urinary tract pathogens from the genus 318 6152360 HT may be distinguished from other

11 Urinary tract pathogens from the genus enteric bacteria by their rapid urease activity a Neisseria Tovidizog 1291 92691 b Proteus c Helicobacter d Escherichia may be distinguished from other ut fitoid 69tu erl liv soloo janW 2 69910

9 What chemical compound is produced by the reduction of thiosulfate a Urea b Hydrogen sulfide c Ammonia d Lactose

6 Enteric bacteria possess the ability to metabolize urea a True b False 69 basH 04 12T TS M12 BE 60 vail Jug 202 laidesime

4 The bacteria grew on the starch plate and there was no visible clearing around the growth once the gram iodine was used Is this a positive or negative starch test

TABLE 47 1 Results for Various Biochemical Tests Test Abbreviation Detects ONPG ADH LDC ODC CIT H S URE TDA IND VP GEL B galactosidase lactose hydrolysis Arginine dihydrolase Lysine decarboxylase Ornithine decarboxylase Citrate utilization Hydrogen sulfide H S production Urea hydrolysis Tryptophan deamination Indole production Acetoin production Voges Proskauer test Gelatin hydrolysis 9 12 Negative Result Colorless Yellow Yellow Yellow Colorless Yellow Colorless light yellow Colorless Colorless Positive Result Yellow pale color is possible 10 11 13 Red or orange Red or orange Red or orange Brown Pink or red Pink or red pale color is possible Black pigment diffuses s

sheet API RESULTS Sample Origin Date Inoculated Step 1 In each yellow circle write a for each positive result and a for each negative result 1999 124 12 4 12 4 1 2 4 1 2 412 412 SOR RHA SAC MEL AMY ARA IND VP GEL GLU MAN INO URE TDA ONPG ADH LDC ODC CIT H2S Step 2 Add the numbers for the positive test results for each section and write the sum in each green oval For example if all three tests in the first section ONPG ADH and LDC were positive you d write a 7 in the first green oval If only ODC and H2S were positive for the second section you d write a 5 in the second green oval Do this until each green oval has a numerical value If none of the tests in a section are positive enter a 0 for the section Step 3 To determine the bacterium s identity look at Table 47 2 and find the 7 digit numerical sequence generated by the green ovals CondBacterium s most likely identity Escherichia coli If the oxidase test was positive add 4 to this last number Note the oxidase test is not on the test strip but counts toward the final ID number

meaning 1960s China accused the that it had revised or abandoned the revolutionary aspects of Marxism in favour of a more moderate less revolutionary approach After Nikita Khrushchev became leader of the Soviet Union he began carrying out a limited de Stalinisation in the USSR and also tried to achieve peaceful coexistence with the West This led the CCP to believe that the Soviet Union was departing from orthodox Marxism especially regarding foreign policy and doing deals with capitalist states These arguments eventually split the international communist movement into pro Moscow and pro Beijing parties However in the early 1970s Mao was also prepared to do deals with the imperialist USA thus showing that Maoism s strong nationalist sentiments at times meant he put China s national interests above those of Communist principles and the goal of world revolution Just like the Soviet Union s leaders Mao often put national interests before ideology Capitalism Essentially this is an ideology based on the belief that the most important parts of a country s economy such as banks industries and the land should be owned and controlled by private individuals and or companies An important part of this belief is the view that the state or government should not be involved in the economy In fact in its early liberal or classical phase in the Industrial Revolution it was believed that apart from providing an army and grudgingly a police force the government should not even provide social welfare This it was argued helped ensure freedom Although most capitalist states eventually developed as liberal political democracies this was not always the case Several capitalist states such s Hitler s Germany in the 1930s and 1940s or Pinochet s Chile in the 970s and 1980s were decidedly undemocratic An indication of how apitalism can be decidedly undemocratic is provided by terms such as ate capitalism bureaucratic capitalism or authoritarian capitalism three of these terms have been applied to China since 1949 o liberal capitalism he 1980s a more extreme version of capitalism emerged which ted Keynesian economics and which in several ways harked back me early form of classical unregulated capitalism In most Western states the welfare capitalism that had emerged by the mid 20th century came increasingly under attack In opposition to the welfare state a return to liberal capitalism was called for instead These moves involved calls for a small state i e one that allowed private firms to take over the provision of various public utilities and welfare services in which taxation of profits was reduced and the rights of trades unions were restricted At first the economic policy associated with this rolling back of the state was often called Monetarism and was quickly adopted by Reagan s governments in the US and by Thatcher s in Britain Such policies were based on the ideas of Friedrich Hayek and Milton Friedman and other theorists linked to the Chicago School of Economics who increasingly argued for an unrestricted capitalism and the privatisation of most publicly owned social services During the 1990s these policies were applied in post Soviet Russia and in the former East European states and this application was often called economic shock therapy Since then these kinds of ideas and policies have usually been referred to as neo liberalism and have been associated with the austerity and privatisation programmes in many Western states following the 2008 banking failures These ideas have also been closely associated with the spread of economic globalisation Dictatorship of the proletariat This Marxist term has three main specialist meanings which in many ways are very different from the usual meaning of dictatorship Firstly in relation to the revolutionary period immediately following the overthrow of capitalism it refers to the dictatorship that would need to be exercised over the old minority ruling class This would involve repression of counter revolutionaries and class enemies to ensure they did not try to overthrow or undermine the revolution and so regain their power However a more significant meaning is dominance or hegemony not harsh and repressive rule According Marxist theory in any class divided society the dominant ideas are always those of the dominant class or classes In a capitalist society these were the private owners of banks factories and land Thus Marx described the parliamentary democracy of late 19th century Britain as the dictatorship of the

Communism Socialism Industrial capitalism Agricultural capitalism Feudalism Slave society Primitive communism Figure 1 4 The Marxist stages of history theory ACTIVITY Before you begin to work your way through this book try to find out a bit more about Marxism and its aims before Mao came to power in China When you have done so write a couple of sentences to explain to what extent you think its aims are a achievable and b desirable Marx s ideas inspired many revolutionaries including Mao in China he first attempt to put them into practice was made in Russia lowing the November 1917 Revolution After the Communist Evolution in 1949 Mao tried to adapt and apply these ideas to China Owever practice turned out to be very different from theory and ny have argued that the ideals of Communism have never yet been blemented anywhere This refers to the political and economic writings of one man Karl Marx 1818 83 or two men if Marx s close collaborator Friedrich Engels 1820 95 is included Marx s writings were based on the materialist conception of history that he developed and on his theory that human history was largely determined by the history of class struggles between ruling and oppressed classes which fundamentally had mutually exclusive or conflicting interests Panifest Kommunistischen Partei Ber ffentligt im Jebruar 1848 Proletarier aller L nder vereinigt ruch London Obra is bre Ciha her Bilbange 6eleillehelt f r Arbeite 1 C Ourghard 45 LITEL STAar B Figure 1 5 Front cover of The Communist Manifesto Marx believed that if the workers were successful in overthrowing capitalism they would then be able to construct a socialist society This would still be a class society but one in which for the first time in human history the ruling class would be the majority of the population From this new form of human society Marx believe it would be possible to move eventually to an even better one communism This mauld l

You are asked to subclone the T7 RNA polymerase in the PGEX 4T 3 vector Which of the following forward primers should you use to PCR amplify your T7 RNA polymerase On the primer sequence the restriction recognition site is underlined and the starting ATG of the T7 RNA polymerase is shown in bold Restriction sites are shown in brackets in the pGEX4T 3 schematic PGEX 4T 3 Thrombin Leu Val Pro Arg Gly Serl Pro Asn Ser Arg Val Asp Ser Ser Gly Arg Ile Val Thr Asp CTG GTT CCG CGT GGA TCC CCG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA t 4 BamHI EcoRI Sall Smal Xhol Notl Stop codons TAATAGGATCCATGAACACGATTAACATCGCTAAG BamHI TAATAGCGGCCGCTGAATGAACACGATTAACATCGCTAAG Notl TAATAGAATTCATGAACACGATTAACATCGCTAAG EcORI TAATACTCGAGCGATGAACACGATTAACATCGCTAAG Xhol TAATANCOCOCCINTCANCACCATTAACATCOSINAC ISmall

PROCEDURE ead the case sections and perform the analyses as structed At the Patient s Bedside A 68 year old man is brought to the emergency department ED of the hospital where you work He reports a severe stabbing pain in his lower back nausea without vomiting and blood in his urine CT scan imaging revealed two kidney stones renal calculi in the left kidney as well as one stone lodged in the urethra and another stuck in the distal portion of the left ureter He is running a fever and has underlying health conditions such as diabetes and heart disease The ED doctor orders urine and blood samples to be collected for microbiological analysis as well as for other tests Once the samples are collected the doctor starts the patient on a broad spectrum intravenous antibacterial drug and admits him for inpatient hospital care In the Clinical Microbiology Lab Day Same Day as Sample Collection You are responsible for analyzing the patient s urine sample and detecting the pathogen of interest You start with a Gram stain of the centrifuged urine sample You observe the following via light microscopy Fig 47 3 FIGURE 47 3 Gram Stain of Centrifuged Urine Sample gram Negative Tod s 1 Gram property 2 Cell shape 3 Cellular arrangement Single 4 Assuming oil immersion microscopy with a 10x ocular and 100x objective what would the final magnification be for the image 1000 5 Based on the Gram stain and morphological information you can make an informed decision about your next steps For each of the following state if you would or would not perform the procedure and explain the reasoning behind your decision Remember performing unnecessary tests takes time and costs your lab money so you would only perform tests that would help you further narrow down the bacterium s identity a Inoculate the sample onto mannitol salt agar MSA b Test the bacteria for coagulase c Test the bacteria for oxidase d Perform an acid fast stain e Inoculate the sample onto eosin methylene blue agar EMB At the Patient s Bedside The infectious disease specialist familiarizes themselves with their newly admitted patient s case In the meantime the assigned urologist also visits the patient They consult on the care plan for their shared patient Their plan primarily centers on removing the lodged kidney stone within the next 12 hours while simultaneously managing the infection that has developed The infectious disease doctor states that the Gram stain data suggests a narrower spectrum drug might be a more desirable option as compared to the broad spectrum drug started in the ED

Communist areas in 1934 Mountains Route of the Long March Great Snow Mountains Mao s Route Yan an October 1935 Yangtze R The Great Wall Xian SHAANXI 4th army route Chonging NUBEI HUNAN Beijing Yellow R Nanjing JIANGXI Yangtze R FUJIAN October 1934 3 Shanghai East China sea TAIWAN Figure 1 2 The route of the Long March The Spirit of Yan an Here as in their earlier soviets in the provinces of Jiangxi and Hubei the Communists began to carry out the reforms that had made them popular Such policies won them new recruits and they were also reinforced by other Communist forces that had escaped from the south As a result their Red Army soon numbered over 80000 n 1937 Japan invaded China so beginning the Second Sino Japanese Var though Japanese incursions into northern China had been creasing since their seizure of the Chinese province of Manchuria 1931 As Jiang had been much more concerned to destroy the CP GMD forces had done little to oppose these Japanese incursions Owever the CCP s Red Army had soon used their guerrilla tactics to st the Japanese a consequence despite suffering further losses the CCP s Red Army ed much support from the peasants eventually in December 1936 g s own troops had forced him to form a United Front with the Introduction Communists against the Japanese invaders However Jiang turned once again on the Communists in 1938 In later years the Spirit of Yan an and the Long March were frequently invoked to remind the Party and the people of the sufferings sacrifices and heroism of the first generation leaders of the CCP The final stages of the Civil War After Japan s surrender and the end of the Second World War in 1945 Mao s Red Army was re organised as the People s Liberation Army PLA and in December 1945 a truce between the GMD and the CCP had been arranged by the US and the Soviet Union Mao s earlier resentment of the Soviet Union s attempts to advise the CCP on what tactics to adopt in the civil war was increased by the pressure that Stalin partly as a result of his agreements with the US and the West about spheres of influence placed on the CCP to form a coalition government with the GMD However civil war broke out again in 1946 when Jiang launched a major offensive against the Communists Despite US aid to the GMD the Communists were strong enough by 1948 to move from guerrilla warfare to direct attacks on Jiang s armies During 1948 49 large numbers of GMD troops then began to desert to the PLA and Jiang even lost control of Nanjing his capital Eventually in October 1949 Mao and the CCP were able to claim victory and announce the formation of the People s Republic of China PRC Government in China today Communist China still officially known as the People s Republic of China PRC is a one party state run by the Chinese Communist Party CCP In theory power is shared between the CCP the People s Government and the People s Liberation Army PLA Although the CCP did have a General Secretary at first the most important Party post in practice was that of Party Chairman the first one being Mao Zedong who held the post until his death in 1976 This post however was later abolished under Deng Xiaoping and the role of General Secretary became more important The CCP also has a Politburo which contains the top leaders of the CCP and a Central Committee The Politburo s smaller Standing Committee meets almost continually and comprises the most powerful and influential leaders Th government known as the State Council is headed by a premier

How many nucleotide s should you add to your forward primer to adjust the reading frame if you are planning to use the restriction site BamH I knowing that the subcloning will be done in pGEX5X 3 pGEX 5X 3 27 4586 01 Factor Xa lle Glu Gly Arg Gly lle Pro Arg Asn Ser Arg Val Asp Ser Ser Gly Arg lle Val Thr Asp ATC GAA GGT CGT GGG ATC CCC AGG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA BamHI EcoRI Sal I Smal Xho I Not I Stop codons 2 1

2 You perform the citrate utilization test and after 48 hours of incubation you make the following observations Should you trus your findings Be sure to explain your reasoning Sample Description E coli E aerogenes Unknown sample 2 Media Color after 48 Hours of Incubation Blue Blue Blue Growth after 48 Hours of Incubation Present Present Present

5 Which of the following are unlikely to grow on Simmons citrate agar Select all that apply a E coli b S flexneri c A bacterium that requires an inorganic nitrogen source d A bacterium that lacks citrate permease e E aerogenes 21

1 It is a Friday afternoon and you head to the lab to inspect the Simmons citrate agar bacterial samples that you inoculated on Wednesday of the same week The samples were all grown at 37 C You do not observe any growth in the tube for your test sample nor for the negative control However the positive control grew just fine You decide your tested bacteria cannot utilize citrate as a sole carbon source Planning to dispose of the samples on Monday you simply place the samples in a test tube rack at room temperature in the biosafety hood where they will be safe until your return When you return to the lab on Monday you notice that your unknown sample has abundant growth and the media is completely blue Your negative control sample still does not exhibit growth and remained green Based on this what can you conclude about your test specimen Be sure to explain your reasoning and provide details from the scenario that support your conclusion

2 The nitrate reduction test is performed using a Differential media b Selective media c Enriched media d Defined media e Synthetic media

2 Which of the following is indicative of a positive test result for citrate utilization Select all that apply a The media appears green and growth is absent b The media appears blue and growth is present c The media appears green and growth is present d The media appears blue and growth is absent

4 The citrate test determines if a bacterium a Metabolizes citrate b Requires a carbon source c Requires a nitrogen source d Produces acidic metabolic byproducts e Is a pathogen

6 Why may a heavy inoculum be problematic in this test a The medium s pH can be falsely elevated if too many bacteria are growing on the agar b You will not be able to achieve colony isolation c You may introduce a contaminant into the agar d You may mistake the inoculum for actual growth e You may be unable to assess the media s color if the slant is overgrown

7 Choose the statement s that accurately describe s Simmons citrate agar select all that apply a It is considered enriched media b It is considered a defined media c There is an organic source of carbon in the media d Simmons citrate agar contains methylene blue as a pH indicator e After incubation you must add reagents to this media before interpreting test results

2 Although strict anaerobes may reduce nitrate the nitrate reduction test as we performed it in this exercise would not determine the nitrate reduction potential of a strict anaerobe Explain why

784 high risk individuals were referred to a lab and tried a new and simple screening for colon cancer To assess the validity of this new screening test all of these individuals also received a diagnostic test for colon cancer a colonoscopy Exactly half of these individuals found through the diagnostic test that they truly have colon cancer However according to the new screening 387 people screened positive for colon cancer The specificity of the new screening is 96 or 0 96 Remember Specificity true negatives from screening all who are actually diagnosed negative Fill in the table and assess the validity of the new colon cancer screening questions 8a f In the table fill in the blank cells and the cells that have a highlighted label Start with the information you know from the problem setup which are the labelled cells that also have asterisks and work from there Screening Screening Diagnostic test total diagnostic test Diagnostic test total diagnostic test 8a number of true positives 8b number of false positives 8c number of false negatives 8d number of true negatives 8e sensitivity of the new screening tect exproccod total screened total screened ww total in study 784

fo 1 Choose the true statement s about nitrate select all that apply a It can be oxidized to nitrite b It can be reduced to molecular nitrogen N c It can serve as a final electron acceptor in anaerobic respiration d It is present in the media used for this exercise e It can be reduced to ammonium

umber the steps below so they are in the proper order for the nitrate reduction test Development of a red color indicates a negative result Add Reagent B Look for a bubble in the Durham tube Inoculate the media Development of a red color indicates a positive result Add Reagent C if no color developed Incubate the media Add Reagent A

6 Assume you see gas in the Durham tube and after adding Reagents A and B a red color develops Based on these observations what can you conclude Select all that apply a The bacterium is an obligate aerobe b The bacterium makes nitrate reductase c The gas observed may be due to a fermentation reaction d The organism is not Neisseria gonorrhoeae e You must add zinc to the media before making any conclusions

continued 1 Suppose you remove your test cultures from the incubator and notice that one of them a known fermenter has a gas bubble in the Durham tube Knowing that fermenters frequently produce gas you ignore the bubble and proceed to the next step Adding reagents produces no change and neither does adding zinc Based on this information what can you conclude Be sure to explain your reasoning

5 Cross out the steps that do not apply to the VP test and then number the remaining steps so they are in the proper orde Add methyl red Immediately observe the sample for a color change Add 1 mL of your sample to a clean tube Inoculate MR VP broth media Add a naphthol Add potassium hydroxide Record a yellow result as having a positive VP test result OM Band

2 In the VP test the most intense color change is often at the media s surface Based on the reaction s chemistry why does this make sense not

6 Cross out the steps that do not apply to the MR test and then number the remaining steps so they are in the proper order Inoculate MR VP broth media Add 1 mL of your sample to a clean tube Add potassium hydroxide Add a naphthol Incubate sample for an hour Record a positive MR test result if a red color develops thuld rod

1 Why is the methyl red test read immediately after addition of methyl red reagent whereas the Voges Proskauer test is read up to 60 minutes after addition of Reagents A and B

Vitamin D deficiency in adults is called melasma osteoporosis Oosteomalacia rickets

4 In this procedure the samples were not transferred into sterile tubes for developing the MR or VP test Why weren t sterile tubes required

2 Select the false statement s about a VP positive bacterium select all that apply a It performs 2 3 butanediol fermentation d b It performs mixed acid fermentation c It produces acetoin d It converts glucose to mostly acidic end products e It cannot metabolize glucose

1 Select the true statement s about an MR negative bacterium select all that apply a It performed mixed acid fermentation b It converted glucose to acidic products c It may convert glucose to acetoin d It produced methyl red e It may perform 2 3 butanediol fermentation

O is released by the action of the thyroid O regulates blood pressure O has a sequence identical to oxytocin O is a physiologically active dipeptide is a hormone that causes the smooth muscles of the mammary glands to ce