Biotechnology: Principles and Processes Questions and Answers

enacted by the Congress in 1966 helped in standardizing quantity descriptions and enabled shoppers to compare the value of competing goods in the stores O The Bait and Switch Act The Fair Packaging and Labelling Act
Biology
Biotechnology: Principles and Processes
enacted by the Congress in 1966 helped in standardizing quantity descriptions and enabled shoppers to compare the value of competing goods in the stores O The Bait and Switch Act The Fair Packaging and Labelling Act
is a judicial doctrine that prevents the government or its political subdivisions departments and agencies from being sued without its consent Nation State Sovereign immunity Nationalization Free State doctrine
Biology
Biotechnology: Principles and Processes
is a judicial doctrine that prevents the government or its political subdivisions departments and agencies from being sued without its consent Nation State Sovereign immunity Nationalization Free State doctrine
is an agreement between the U S Mexico and Canada which indicates no tariff will be imposed upon goods sold between these three countries Mercosur NAFTA Free Trade Area of the Americas etic Froo Trade Area
Biology
Biotechnology: Principles and Processes
is an agreement between the U S Mexico and Canada which indicates no tariff will be imposed upon goods sold between these three countries Mercosur NAFTA Free Trade Area of the Americas etic Froo Trade Area
Title VII of the Civil Rights Act of 1964 outlawed discrimination in employment based on race religion sex or national origin outlawed negotiations between an employer and labor unions declared the open shop type of agreements unlawful declared the closed shop type of agreements unlawful
Biology
Biotechnology: Principles and Processes
Title VII of the Civil Rights Act of 1964 outlawed discrimination in employment based on race religion sex or national origin outlawed negotiations between an employer and labor unions declared the open shop type of agreements unlawful declared the closed shop type of agreements unlawful
A biochemistry laboratory student used the Bradford protein assay to measure the lysozyme protein content in egg whites The Bradford protein assay is a spectrophotometric technique that uses a dye Coomassie Brilliant Blue whose absorption undergoes a spectroscopic shift when bound to a protein In the unbound state Coomassie Brilliant Blue displays a red color As protein binds to the dye its absorbance at 595 nm increases and the dye changes to a blue color The student prepared a 3 600 mL sample containing 2 mg mL Coomassie Brilliant Blue To this sample 300 0 L of 70 0 g mL lysozyme was added and an absorbance of 0 264 was measured at 595 nm Calculate the corrected absorbance for this sample atod absorbance
Biology
Biotechnology: Principles and Processes
A biochemistry laboratory student used the Bradford protein assay to measure the lysozyme protein content in egg whites The Bradford protein assay is a spectrophotometric technique that uses a dye Coomassie Brilliant Blue whose absorption undergoes a spectroscopic shift when bound to a protein In the unbound state Coomassie Brilliant Blue displays a red color As protein binds to the dye its absorbance at 595 nm increases and the dye changes to a blue color The student prepared a 3 600 mL sample containing 2 mg mL Coomassie Brilliant Blue To this sample 300 0 L of 70 0 g mL lysozyme was added and an absorbance of 0 264 was measured at 595 nm Calculate the corrected absorbance for this sample atod absorbance
True or False Drinking the milk supplied or eating the cheese produced in this lab will result in you earning a grade of zerc Select one O True O False
Biology
Biotechnology: Principles and Processes
True or False Drinking the milk supplied or eating the cheese produced in this lab will result in you earning a grade of zerc Select one O True O False
Question 71 Listen Creators of the Shake Weight a moving dumbbell claim that their product can produce incredi of the additional information below would provide the strongest evidence supporting the effectiveness of the Shake Weight for increasing muscle strength Survey data indicates that on average users of the Shake Weight report working out with the product 6 days per week whereas users of standard dumbbells report working out 3 days per week Compared to a resting state users of the Shake Weight had a 300 increase in blood flow to their muscles when using the product O Survey data indicates that users of the Shake Weight reported significantly greater muscle tone compared to users of standard dumbbells Compared to users of standard dumbbells users of the Shake Weight were able to lift weights that were significantly heavier at the end of an 8 week trial
Biology
Biotechnology: Principles and Processes
Question 71 Listen Creators of the Shake Weight a moving dumbbell claim that their product can produce incredi of the additional information below would provide the strongest evidence supporting the effectiveness of the Shake Weight for increasing muscle strength Survey data indicates that on average users of the Shake Weight report working out with the product 6 days per week whereas users of standard dumbbells report working out 3 days per week Compared to a resting state users of the Shake Weight had a 300 increase in blood flow to their muscles when using the product O Survey data indicates that users of the Shake Weight reported significantly greater muscle tone compared to users of standard dumbbells Compared to users of standard dumbbells users of the Shake Weight were able to lift weights that were significantly heavier at the end of an 8 week trial
Question 7 1 point Listen Creators of the Shake Weight a moving dumbbell claim that their product can produce incredible of the additional information below would provide the strongest evidence supporting the effectiveness of the Shake Weight for increasing muscle strength Survey data indicates that on average users of the Shake Weight report working out with the product 6 days per week whereas users of standard dumbbells report working out 3 days per week O Compared to a resting state users of the Shake Weight had a 300 increase in blood flow to their muscles when the product using Survey data indicates that users of the Shake Weight reported significantly greater muscle tone compared to users of standard dumbbells Compared to users of standard dumbbells users of the Shake Weight were able to lift weights that were significantly heavier at the end of an 8 week trial
Biology
Biotechnology: Principles and Processes
Question 7 1 point Listen Creators of the Shake Weight a moving dumbbell claim that their product can produce incredible of the additional information below would provide the strongest evidence supporting the effectiveness of the Shake Weight for increasing muscle strength Survey data indicates that on average users of the Shake Weight report working out with the product 6 days per week whereas users of standard dumbbells report working out 3 days per week O Compared to a resting state users of the Shake Weight had a 300 increase in blood flow to their muscles when the product using Survey data indicates that users of the Shake Weight reported significantly greater muscle tone compared to users of standard dumbbells Compared to users of standard dumbbells users of the Shake Weight were able to lift weights that were significantly heavier at the end of an 8 week trial
6 Collaboration involves OA taking charge and telling others what to do OB very little netiquette OC a high speed Internet connection D working with others on a project or activity
Biology
Biotechnology: Principles and Processes
6 Collaboration involves OA taking charge and telling others what to do OB very little netiquette OC a high speed Internet connection D working with others on a project or activity
Which of the following must be considered when designing an experime Select one O a Control s O b O c Number of replicates O d All of these answers Variables to be kept constant
Biology
Biotechnology: Principles and Processes
Which of the following must be considered when designing an experime Select one O a Control s O b O c Number of replicates O d All of these answers Variables to be kept constant
of cion Which of the following is a testable hypothesis Select one a Bacteria populations increase with temperature O b Bacteria do not like temperatures above 30 degrees Celsius O c Bacteria are happiest when they are warm O d All of the above are testable
Biology
Biotechnology: Principles and Processes
of cion Which of the following is a testable hypothesis Select one a Bacteria populations increase with temperature O b Bacteria do not like temperatures above 30 degrees Celsius O c Bacteria are happiest when they are warm O d All of the above are testable
The partial negative charge at one end of a water molecule is attracted to the partial positive charge of another water molecule What is this attraction called a van der Waals interaction an ionic bond a covalent bond a hydrogen bond Question 9 1 point Saved
Biology
Biotechnology: Principles and Processes
The partial negative charge at one end of a water molecule is attracted to the partial positive charge of another water molecule What is this attraction called a van der Waals interaction an ionic bond a covalent bond a hydrogen bond Question 9 1 point Saved
The toxic granules used by cytolytic cells like NK natural killer cells to kill or degrade other cells or pathogen consist of what molecules A Perforin B Lysozyme Og Granzyme OD Both a and b
Biology
Biotechnology: Principles and Processes
The toxic granules used by cytolytic cells like NK natural killer cells to kill or degrade other cells or pathogen consist of what molecules A Perforin B Lysozyme Og Granzyme OD Both a and b
Match the following 1 Plaintiff ii Jurisdictions iii Defendant iv Docket O a Person whom the complaint is against b Person who files the suit c List of cases to be heard d Authority of a court to decide a case i c ii d iii b iv a O i b ii d iii a iv c O i a ii b iii d iv c O i d ii a iii c iv b
Biology
Biotechnology: Principles and Processes
Match the following 1 Plaintiff ii Jurisdictions iii Defendant iv Docket O a Person whom the complaint is against b Person who files the suit c List of cases to be heard d Authority of a court to decide a case i c ii d iii b iv a O i b ii d iii a iv c O i a ii b iii d iv c O i d ii a iii c iv b
Gen 2 Before Pesticides Non Resistant Resistant Gen 3 Before Pesticides Non Resistant Resistan 100 25 ducing I noticed from all the graphs Non Resistant would become extid Inoticed from all the graphs The resistant aphids would increase Gen 4 Before Pesticides Non Resistant Resistant 100 75 50 25 0 100 75 50 25 Gen 2 After Pesticides Non Restar Gen 3 After Pesticides Non Resistant Restor
Biology
Biotechnology: Principles and Processes
Gen 2 Before Pesticides Non Resistant Resistant Gen 3 Before Pesticides Non Resistant Resistan 100 25 ducing I noticed from all the graphs Non Resistant would become extid Inoticed from all the graphs The resistant aphids would increase Gen 4 Before Pesticides Non Resistant Resistant 100 75 50 25 0 100 75 50 25 Gen 2 After Pesticides Non Restar Gen 3 After Pesticides Non Resistant Restor
2 The table below shows partial diploid E coli with expression of beta galactosidase is None absent Basal on but low expression High on and activated expression when grown in either lactose only or glucose onl
Biology
Biotechnology: Principles and Processes
2 The table below shows partial diploid E coli with expression of beta galactosidase is None absent Basal on but low expression High on and activated expression when grown in either lactose only or glucose onl
2 T cell dependent activation vs T cell independent activation of B cells which one is faster and which one is more effective Answer
Biology
Biotechnology: Principles and Processes
2 T cell dependent activation vs T cell independent activation of B cells which one is faster and which one is more effective Answer
Cytochrome c is a protein found in all eukaryotes The table shows how the cytochrome c sequences in five species compare with the sequence in humans Comparison of Cytochrome Sequences Among Species Species Human Chimpanzee Sheep Rattlesnake Carp Garden snail Number of differences compared with humans 0 10 14 18 29 Percentage difference What conclusion can you draw from the data 0 10 13 17 28 A Chimpanzees evolved from sheep B Sheep and rattlesnakes both evolved from carp C Humans are more closely related to chimpanzees than to carp D Humans and chimpanzees are the same species
Biology
Biotechnology: Principles and Processes
Cytochrome c is a protein found in all eukaryotes The table shows how the cytochrome c sequences in five species compare with the sequence in humans Comparison of Cytochrome Sequences Among Species Species Human Chimpanzee Sheep Rattlesnake Carp Garden snail Number of differences compared with humans 0 10 14 18 29 Percentage difference What conclusion can you draw from the data 0 10 13 17 28 A Chimpanzees evolved from sheep B Sheep and rattlesnakes both evolved from carp C Humans are more closely related to chimpanzees than to carp D Humans and chimpanzees are the same species
Senetic engineering is used in agriculture to create genetically modified organisms such as crop plants that are more resistant to lisease Which of the following describes a possible risk of genetically modifying a crop species OA an increase in the amount of the crop that is harvested each year SOB a decrease in the amount of pesticides that need to be used on the crop OC a decrease in the genetic diversity of the crop species OD an increase in the ability of the crop species to survive harsh conditions
Biology
Biotechnology: Principles and Processes
Senetic engineering is used in agriculture to create genetically modified organisms such as crop plants that are more resistant to lisease Which of the following describes a possible risk of genetically modifying a crop species OA an increase in the amount of the crop that is harvested each year SOB a decrease in the amount of pesticides that need to be used on the crop OC a decrease in the genetic diversity of the crop species OD an increase in the ability of the crop species to survive harsh conditions
900 l 100 ul 500 CD Why 900 l 100 50 100 E l 5 he density of the original culture Remember that d to ml for the equation to work
Biology
Biotechnology: Principles and Processes
900 l 100 ul 500 CD Why 900 l 100 50 100 E l 5 he density of the original culture Remember that d to ml for the equation to work
Which is your preferred solution Explain why using your cost benefit analysis evidence and scientific ideas to support your choice My preferred solution is Based on my cost benefit analysis The scientific ideas that support this choice are
Biology
Biotechnology: Principles and Processes
Which is your preferred solution Explain why using your cost benefit analysis evidence and scientific ideas to support your choice My preferred solution is Based on my cost benefit analysis The scientific ideas that support this choice are
A mutation which has no effect on the protein it is coding for is referred to as a an silent point induced spontaneous mutation
Biology
Biotechnology: Principles and Processes
A mutation which has no effect on the protein it is coding for is referred to as a an silent point induced spontaneous mutation
discovered in 1944 that the transforming principle molecule Acceptable Formats
Biology
Biotechnology: Principles and Processes
discovered in 1944 that the transforming principle molecule Acceptable Formats
2 Starting with the original chromosomes pictured in question 1 draw all of the gamete types that would result from a double crossing over event One crossover is between the F locus and the G locus the other is between G and H Indicate which have the parental and which the recombinantg arrangement of alleles and write the genotype of each gamete 1 pt Ffff G HT
Biology
Biotechnology: Principles and Processes
2 Starting with the original chromosomes pictured in question 1 draw all of the gamete types that would result from a double crossing over event One crossover is between the F locus and the G locus the other is between G and H Indicate which have the parental and which the recombinantg arrangement of alleles and write the genotype of each gamete 1 pt Ffff G HT
1 In an organism with the chromosomes shown a cell undergoes meiosis Draw all of the gamete types that would result from a single crossing over event somewhere between the F locus and the G locus Indicate which have the parental and which the recombinant arrangement of alleles and write the genotype of each gamete be sure that upper and lowercase characters are distinct 1 pt F 60 g f G H h
Biology
Biotechnology: Principles and Processes
1 In an organism with the chromosomes shown a cell undergoes meiosis Draw all of the gamete types that would result from a single crossing over event somewhere between the F locus and the G locus Indicate which have the parental and which the recombinant arrangement of alleles and write the genotype of each gamete be sure that upper and lowercase characters are distinct 1 pt F 60 g f G H h
The hot pink growth on this MacConkey plate are most likely the gram positive bacteria Staphylococcus aureus True
Biology
Biotechnology: Principles and Processes
The hot pink growth on this MacConkey plate are most likely the gram positive bacteria Staphylococcus aureus True
Which of the following is a con negative of having a two party system O political parties take public attention away from important government issues O political parties have to keep their policies more broad to attract more supporters Othere are too many choices of who to vote for in elections O prevents interest groups from having a strong voice
Biology
Biotechnology: Principles and Processes
Which of the following is a con negative of having a two party system O political parties take public attention away from important government issues O political parties have to keep their policies more broad to attract more supporters Othere are too many choices of who to vote for in elections O prevents interest groups from having a strong voice
Patients with some forms of cancer receive bone marrow transplants as treatment What type of biotechnology is this treatment O A gene mapping cloning gene therapy stem cell therapy OB O C OD
Biology
Biotechnology: Principles and Processes
Patients with some forms of cancer receive bone marrow transplants as treatment What type of biotechnology is this treatment O A gene mapping cloning gene therapy stem cell therapy OB O C OD
Genetic engineering is the process of manipulating genes for practical purposes How could genetic engineering most likely benefit people with genetic diseases in the future O A Genes causing diseases could be eradicated from the human genome through the use of restriction enzymes Genes causing diseases could be cloned and placed into other human cells Genes causing diseases could be replaced with various types of plant genes Genes causing diseases could be replaced through the use of recombinant DNA OB O C OD
Biology
Biotechnology: Principles and Processes
Genetic engineering is the process of manipulating genes for practical purposes How could genetic engineering most likely benefit people with genetic diseases in the future O A Genes causing diseases could be eradicated from the human genome through the use of restriction enzymes Genes causing diseases could be cloned and placed into other human cells Genes causing diseases could be replaced with various types of plant genes Genes causing diseases could be replaced through the use of recombinant DNA OB O C OD
Provide the sources for your evidence list each link on a separa Source Links Link 1 Link 2 Link 3 Purpose In this assessment you will construct an explanation based on evidence for how the availability of natural resources occurrence of natural hazards and changes in climate have influenced human activity
Biology
Biotechnology: Principles and Processes
Provide the sources for your evidence list each link on a separa Source Links Link 1 Link 2 Link 3 Purpose In this assessment you will construct an explanation based on evidence for how the availability of natural resources occurrence of natural hazards and changes in climate have influenced human activity
A common type of succession that occurs where an event such as a forest fire has occurred or a farmer s field has been abandoned is called secondary succession primary succession Quaternary succession common succession
Biology
Biotechnology: Principles and Processes
A common type of succession that occurs where an event such as a forest fire has occurred or a farmer s field has been abandoned is called secondary succession primary succession Quaternary succession common succession
You are examining the MIC and MBC data from an experiment testing a new drug s activity against a strain of methicillin resistant Staphylococcus aureus Based on the results shown in the table from the experiment s what are the MIC and MBC values for this antibiotic MIC 150 mg mL MBC 37 5 mg mL MIC 37 5 mg mL MBC 150 mg mL MIC 150 mg mL MBC 75 mg mL MIC 75 mg ml
Biology
Biotechnology: Principles and Processes
You are examining the MIC and MBC data from an experiment testing a new drug s activity against a strain of methicillin resistant Staphylococcus aureus Based on the results shown in the table from the experiment s what are the MIC and MBC values for this antibiotic MIC 150 mg mL MBC 37 5 mg mL MIC 37 5 mg mL MBC 150 mg mL MIC 150 mg mL MBC 75 mg mL MIC 75 mg ml
Question 4 What are the uses of recombinant DNA pharmaceuticals Choose Human growth hormone Human insulin Erythropoietin DNase to treat viscous secretions in CF Question 5
Biology
Biotechnology: Principles and Processes
Question 4 What are the uses of recombinant DNA pharmaceuticals Choose Human growth hormone Human insulin Erythropoietin DNase to treat viscous secretions in CF Question 5
estion 12 ect all the terms that apply to plant virusoid RNA Capsid
Biology
Biotechnology: Principles and Processes
estion 12 ect all the terms that apply to plant virusoid RNA Capsid
is a dideoxynucleotide Sanger sequencing gel for an unknown DNA rately and run on separate lanes of the gel What is the sequence of th ddTTP ddCTP ddGTP
Biology
Biotechnology: Principles and Processes
is a dideoxynucleotide Sanger sequencing gel for an unknown DNA rately and run on separate lanes of the gel What is the sequence of th ddTTP ddCTP ddGTP
ION 15 tion enzymes recognize particular double stranded DNA sequences and on the bacterium from which they were first isolated For example the e ames and recognition sites for several restriction enzymes are shown bel nition site Note that an N in the recognition sequence means that the ate where the enzyme breaks the phosphodiester bond between the 3 ca Mall comc 21 BglII CARC 50 BamHI dramon
Biology
Biotechnology: Principles and Processes
ION 15 tion enzymes recognize particular double stranded DNA sequences and on the bacterium from which they were first isolated For example the e ames and recognition sites for several restriction enzymes are shown bel nition site Note that an N in the recognition sequence means that the ate where the enzyme breaks the phosphodiester bond between the 3 ca Mall comc 21 BglII CARC 50 BamHI dramon
FIGURE 28 6 Analysis Using ear lobe shape indicate genotypes for 2
Biology
Biotechnology: Principles and Processes
FIGURE 28 6 Analysis Using ear lobe shape indicate genotypes for 2
Basic Chemistry All things in the universe including living things are composed of one or more elements the fundamental building blocks of matter Matter is anything that occupies space and has mass An element is a substance that cannot be divided into simpler substances by chemical reactions Although over 100 elements have been identified only a few of them make up living organisms carbon hydrogen oxygen nitrogen calcium phosphorous iron sodium and potassium Of these the four elements that constitute about 96 of our body weight are carbon hydrogen oxygen and nitrogen Chemistry is the science that studies the composition of matter Inorganic chemistry studies the composition of non living substances that generally do not contain carbon Organic chemistry studies the carbon based chemistry or biochemistry of the living organism An understanding of the atomic structure bonding behavior of elements and structure of the most abundant organic molecules carbohydrates proteins lipids and nucleic acids is basic to comprehending the physiology of the body as a whole The following exercises may be completed by referring to Chapter 2 in your text and by using the molecular model kits in the laboratory Exercise 1 Inorganic Chemistry Give the chemical symbols for each of the following elements oxygen iodine calcium Magnesium carbon hydrogen sodium chlorine potassium nitrogen phosphorus iron Draw the orbital diagram of an atom using the carbon atom as an example Describe the particles that make up the atom by giving their mass electrical charge and location within the atom
Biology
Biotechnology: Principles and Processes
Basic Chemistry All things in the universe including living things are composed of one or more elements the fundamental building blocks of matter Matter is anything that occupies space and has mass An element is a substance that cannot be divided into simpler substances by chemical reactions Although over 100 elements have been identified only a few of them make up living organisms carbon hydrogen oxygen nitrogen calcium phosphorous iron sodium and potassium Of these the four elements that constitute about 96 of our body weight are carbon hydrogen oxygen and nitrogen Chemistry is the science that studies the composition of matter Inorganic chemistry studies the composition of non living substances that generally do not contain carbon Organic chemistry studies the carbon based chemistry or biochemistry of the living organism An understanding of the atomic structure bonding behavior of elements and structure of the most abundant organic molecules carbohydrates proteins lipids and nucleic acids is basic to comprehending the physiology of the body as a whole The following exercises may be completed by referring to Chapter 2 in your text and by using the molecular model kits in the laboratory Exercise 1 Inorganic Chemistry Give the chemical symbols for each of the following elements oxygen iodine calcium Magnesium carbon hydrogen sodium chlorine potassium nitrogen phosphorus iron Draw the orbital diagram of an atom using the carbon atom as an example Describe the particles that make up the atom by giving their mass electrical charge and location within the atom
3 A reasonable weight loss goal is to lose 10 O 15 20 of weight over 6 months
Biology
Biotechnology: Principles and Processes
3 A reasonable weight loss goal is to lose 10 O 15 20 of weight over 6 months
1 Losing weight is harder than maintaining the weight loss True False
Biology
Biotechnology: Principles and Processes
1 Losing weight is harder than maintaining the weight loss True False
You are amplifying the region below What is the primer sequence that would be used to make a copy using the top strand as a template Note pretend primers are only 6 nucleotides long here normally they are 20 nucleotides long also normally you would need a primer to copy the bottom strand template as well but you are not asked for the sequence O 5 AATGAT3 5 GTTACT3 5 CAATGATTCATGGCATTGCATCGAT3 3 GTTACTAAGTACCGTAACGTAGCTA5 O 3 GTTACT5 FAISCAT
Biology
Biotechnology: Principles and Processes
You are amplifying the region below What is the primer sequence that would be used to make a copy using the top strand as a template Note pretend primers are only 6 nucleotides long here normally they are 20 nucleotides long also normally you would need a primer to copy the bottom strand template as well but you are not asked for the sequence O 5 AATGAT3 5 GTTACT3 5 CAATGATTCATGGCATTGCATCGAT3 3 GTTACTAAGTACCGTAACGTAGCTA5 O 3 GTTACT5 FAISCAT
Most amino acids have more than one codon and attach to more than one tRNA each with a different anticodon Write all possible anticodons for the four codons of glycine 5 GGU GGC GGA and GGG From your answer which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine middle position 3 position 5 position Classify each anticodon for glycine based on whether its anticodon codon pairing has a wobbly base pair or the pairing exhibits strong Watson Crick hydrogen bonding at all three positions Wobbly base pair Strong hydrogen bonding at all three positions
Biology
Biotechnology: Principles and Processes
Most amino acids have more than one codon and attach to more than one tRNA each with a different anticodon Write all possible anticodons for the four codons of glycine 5 GGU GGC GGA and GGG From your answer which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine middle position 3 position 5 position Classify each anticodon for glycine based on whether its anticodon codon pairing has a wobbly base pair or the pairing exhibits strong Watson Crick hydrogen bonding at all three positions Wobbly base pair Strong hydrogen bonding at all three positions
CUT 50 CONTENTS Tools Help Section 4 An Extended Exploration The t Te Isle Roya kilograms of body weight yes it is possible to estimate fat stores for live moose 1 Calculate the average value of the fat ores for sampled moose with wolves absent left half of the table and type it into the box labeled xa which is the sample mean The subscript a represents wolf absence Tip A calculator is available by selecting Calculator from the CONTENTS menu button in top left corner
Biology
Biotechnology: Principles and Processes
CUT 50 CONTENTS Tools Help Section 4 An Extended Exploration The t Te Isle Roya kilograms of body weight yes it is possible to estimate fat stores for live moose 1 Calculate the average value of the fat ores for sampled moose with wolves absent left half of the table and type it into the box labeled xa which is the sample mean The subscript a represents wolf absence Tip A calculator is available by selecting Calculator from the CONTENTS menu button in top left corner
4 Name and describe the three stages of annealing process Explain how dislocations are involved in each of the strengthening mechanisms What is the driving force for annealing
Biology
Biotechnology: Principles and Processes
4 Name and describe the three stages of annealing process Explain how dislocations are involved in each of the strengthening mechanisms What is the driving force for annealing
AAGPBL was formed because of World War II 1939 1945 The war rought big changes to American society There was even talk of ausing Major League Baseball MLB The country was sending millions of men overseas to fight and that meant there were fewer players and fans Philip Wrigley pitched a new idea He was the owner of MLB s Chicago Cubs He proposed a women s professional league The game would be a mix of softball and baseball Hundreds of female players tried out The league s first season in 1943 had just four teams More teams were added later There were strict rules Wrigley insisted that looks and good manners were as important as fastballs and home runs Players had to go to charm school They were coached in how to dress and wear makeup On field and off they had to wear lipstick Game uniforms included skirts The result was a lot of skinned knees Sophie Kurys played 11 seasons in the league According to Kurys the league wanted them to act girlish and play like superstars What they didn t realize was how well the girls could actually play she said Based on the article the reader can tell that A many AAGPBL players would probably not have gone to charm school if the league hadn t made them go B Philip Wrigley began the AAGPBL because he no longer wanted to own the Chicago Cubs C most of the players in the AAGPBL were grateful when the league shut down in 1954 D Pepper Davis tried out for the AAGPBL because she thought baseball would be easier to play than softball SUBMIT
Biology
Biotechnology: Principles and Processes
AAGPBL was formed because of World War II 1939 1945 The war rought big changes to American society There was even talk of ausing Major League Baseball MLB The country was sending millions of men overseas to fight and that meant there were fewer players and fans Philip Wrigley pitched a new idea He was the owner of MLB s Chicago Cubs He proposed a women s professional league The game would be a mix of softball and baseball Hundreds of female players tried out The league s first season in 1943 had just four teams More teams were added later There were strict rules Wrigley insisted that looks and good manners were as important as fastballs and home runs Players had to go to charm school They were coached in how to dress and wear makeup On field and off they had to wear lipstick Game uniforms included skirts The result was a lot of skinned knees Sophie Kurys played 11 seasons in the league According to Kurys the league wanted them to act girlish and play like superstars What they didn t realize was how well the girls could actually play she said Based on the article the reader can tell that A many AAGPBL players would probably not have gone to charm school if the league hadn t made them go B Philip Wrigley began the AAGPBL because he no longer wanted to own the Chicago Cubs C most of the players in the AAGPBL were grateful when the league shut down in 1954 D Pepper Davis tried out for the AAGPBL because she thought baseball would be easier to play than softball SUBMIT
on 6 et ered Which of the following Select one JAnt
Biology
Biotechnology: Principles and Processes
on 6 et ered Which of the following Select one JAnt
otope ratios show a cyclical pattern of change over tens of thousands of years What causes this pattern The number of humans living on the planet Variations in solar energy Ice ages and periods of warmer climate The amount of carbon dioxide released into the atmosphere
Biology
Biotechnology: Principles and Processes
otope ratios show a cyclical pattern of change over tens of thousands of years What causes this pattern The number of humans living on the planet Variations in solar energy Ice ages and periods of warmer climate The amount of carbon dioxide released into the atmosphere
4 You re conducting a macrobroth dilution test to determine the MIC and MBC of a new antibiotic drug against E coli You determine the MIC of your antibiotic against E coli is 16 g mL You then plate a small sample from your 16 g mL on TSA incubate it and discover colonies of growth the next day Is 16 g mL the MBC of your antibiotic against E coli Why or why not
Biology
Biotechnology: Principles and Processes
4 You re conducting a macrobroth dilution test to determine the MIC and MBC of a new antibiotic drug against E coli You determine the MIC of your antibiotic against E coli is 16 g mL You then plate a small sample from your 16 g mL on TSA incubate it and discover colonies of growth the next day Is 16 g mL the MBC of your antibiotic against E coli Why or why not
You are searching for an ORF that could be the protein coding sequence for your candidate gene One of the possible reading frames is interrupted by multiple stop codons Do you think this is your ORF O Yes O No
Biology
Biotechnology: Principles and Processes
You are searching for an ORF that could be the protein coding sequence for your candidate gene One of the possible reading frames is interrupted by multiple stop codons Do you think this is your ORF O Yes O No
ks S Home Schoology TEXT NEWinter and Om Match the following terms with their appropriate definition Mutation Gene Flow Non Random Mating Genetic Drift neworening Natural Selection
Biology
Biotechnology: Principles and Processes
ks S Home Schoology TEXT NEWinter and Om Match the following terms with their appropriate definition Mutation Gene Flow Non Random Mating Genetic Drift neworening Natural Selection