Cell Cycle and Cell Division Questions and Answers

5 What is cancer O When the mitosis of cells stops O When the cells destroy themselves O Out of control cell growth and division

Homologous chromosomes synapse and crossing over occurs This occurs when a cell divides to form two cells that are genetically identical Centromeres split and sister chromatids are separated from each other Separation of Homologous chromosomes Two haploid cells the result Choose Choose This statement is true for anaphase I of meiosis I only This statement is true for mitosis and meiosis II This statement is for true for mitosis only This statement is true for mitosis and meiosis This statement is true for telophase I with cytokinesis complete This statement is true for telekinesis I This statement is true for cytoknesis at the end of mitosis This statement is true for Telophase II This statement is true for prometaphase of mitosis This statement is true for meiosis I only Choose

Which of the following is true of a species that has a chromosome number of 2n 16 During the S phase of the cell cycle there will be 32 separate chromosomes The species is diploid with 32 chromosomes O There are 16 homologous pairs O The species has 16 different types of chromosomes O A gamete from this species has 8 chromosomes

2 A cancer cell has a very high division rate even when no growth factors are present Which of the following a A gain of function mutation in a growth factor receptor gene b A gain of function mutation in the gene encoding the retinoblastoma protein that regulates entry into the cell cycle c A loss of function mutation in a cyclin gene d None of the other answer choices are correct e More than one of the other answer choices are correct

3 27 Cel din indudes O Ob interphase 04 iphase proph which is division of the nudes and which is

The primary function of Asters in mitosis is Select one O a The dissociation of the nuclear envelop O b The formation of microtubule spindles to separate the daughter chromosom c The formation of microfilaments needed to hold chromosomes O d The production of microfilaments spindles to separate the two sister chromatids O e Formation of a cleavage furrow

What will be the chromosome structure of cells produced from a germ cell at the end of meiosis I with cytokinesis complete O The chromosomes will be in homologous pairs O The chromosomes would be duplicated O The chromosomes would be unduplicated O There will be both duplicated and unduplicated chromosomes O The chromosomes would consist of a single unit

Answer the following questions I expect your answers to be in your own words You can include analogies to explain what is happening For example you could say a nucleus is like a library and the books are chromosomes A List and describe the stages of mitosis and meiosis Include a description of interphase and cytokinesis 1 B Compare and contrast mitosis and meiosis

36 Which is the direct target of S cdk which starts DNA replication A S cyclin B Cdc6 C Origin Replication Complex D DNA polymerase

Why is meiosis important for sexual reproduction It allows the zygote formed from fertilization to have half the original number of chromosomes of the organism It allows gametes to have half the original number of chromosomes of the organism It allows the zygote formed from fertilization to have triple the chromosome number of the organism It allows gametes to have twice the original number of chromosomes of the organism

What is the Maturation Promoting Factor MPF A an inactive enzyme that is waiting for activation by a cell surface signal B a kinase complex that is active when the levels of s cyclin rise in the cell C a kinase complex that is active when the levels of m cyclin rise in the cell D a phosphorylase that becomes active when cdk rises during S phase E a phosphorylase activated by cyclin in G1 phase

Which of the following represents the correct order of events during mitosis A anaphase telophase metaphase cytokinesis B prophase telophase anaphase metaphase C mitosis 1 mitosis 2 cytokinesis D prophase metaphase anaphase telophase E interphase binary fission cell division

8 APC Anaphase Promoting Complex is responsible for which of the following events A Phosphorylation of nuclear lamins B Cleavage of kinetochore microtubules C Cleavage of cohesins

6 Which microtubules overlap and push the centrosomes farther apart during mitosis A aster B kinetechore C interpolar D contractile ring F ciliary

Which class of proteins increase in concentration and then are rapidly degraded in controlling the cell cle A ubiquitins B phosphatases C kinases D Cdk inhibitory proteins E cyclins

What phase of mitosis is associated with phosphorylation of nuclear envelope proteins A telophase B anaphase C prophase D prometaphase E metaphase

14 DNA damages causes an upregulation of p53 protein to inhibit progression through the cell cycle How does p53 block the cell cycle

What is an advantage of a degenerate genetic code Mutations are less likely to alter protein sequence decreasing the chances that a mutation will have deleterious consequences to the organism Mutations are more likely to alter proteins increasing the rate of evolution It increases the number of possible proteins that can be coded by each gene All of the above

58 What is the name for the proteins that DNA wraps around to form chromosomes 59 What is the final product of translation 60 Which of the following is the result of a nondisjunction during meiosis a mutation a missing chromosome a misfolded protein or a missing nucleus

List the stages of meiosis I and explain the events that occur during each stage Short Answer Toolbar navigation

A cell is placed in a solution and almost immediately water begins to exit the cell causing it to undergo plasmolysis whereby it shrinks Compared to this cell the solution it was placed in must therefore be O hypertonic O hypotonic Oisotonic O There is not enough information provided to determine the tonirituof 2 pts

Tetrad formation or synapsis and cross over occur during this phase of meiosis telophase 2 metaphase 2 anaphase 1 Str

3 points Pollination is an example of Ochemical diversity O O crop pest control 2 a possible source of new drugs an ecosystem service

Which table correctly compares a virus and a living organism B Characteristic Composition Reproduction Genetic material Organelles Crystallization Characteristic Composition Reproduction Genetic material Organelles Crystallization Characteristic Composition Reproduction Genetic material Organelles Crystallization Characteristic Composition Reproduction Genetic material Organelles Crystallization Virus cells through cell division DNA or RNA contains organelles cannot survive Virus genetic material and proteins through a host cell DNA or RNA does not contain organelles can survive Virus cells through a host cell DNA and RNA does not contain organelles cannot survive Virus cells through cell division DNA and RNA contains organelles can survive Living Organism genetic material and proteins through a host cell DNA or RNA does not contain organelles can survive Living Organism cells through cell division DNA and RNA contains organelles cannot survive Living Organism genetic material and proteins through cell division DNA or RNA contains organelles can survive Living Organism cells through a host cell DNA and RNA does not contain organelles cannot survive

When a eukaryotic cell undergoes cellular division creating two new daughter cells that have the same number of chromosomes as the parent cell the cell has undergon A mitosis B C D meiosis cellular respiration endocytosis

A fruit fly has the recessive trait of short wings It is crossed with a fly which is homozygous for the dominant allele of the gene and has the dominant trait of medium length wings What percentage of the offspring of this cross will most likely have the recessive trait of shor wings A 0 B 25 C 50 D 100

Airbags in automobiles during the collision reduce the impact force by extending the collision time O increase the impact force by extending the collision time increase the momentum by extending the collision time O reduce the impact force by reducing the collision time

Gene Mapping The fact that Gregor Mendel decided to study pea plants was a stroke of sheer luck Not only is it a simple organism to study but the characteristics he studied assorted independently from each other which allowed him to create the foundation of modem genetics Let s quickly review independent assortment using a hypothetical plant species that has a diploid number of 4 2n 4 For this plant seed texture and plant height are controlled by two different genes Seed texture can either be rough R or smooth r and plant height can either be tall T or short t We will assume independent assortment meaning the genes for seed texture and height are on separate chromosomes the gene for seed texture is on chromosome 1 and the gene for plant height is on chromosome 2 A cross is performed between a RRTT parent and a rrtt parent 1 Predict the genotypes of the F1 progeny T Chromosome 1 R Xa 2 Using the four cells below determine the possible products of meiosis that would be generated by the F progeny the first one has been done for you OO Chromosome 2 Next a testcross is performed between an F1 individual and an individual that is rtt Use the space below to perform the cross Identify the possible phenotypes and their ratios in the offspring

64 A b sandwich forms when A two hydrophobic sides of b sheets interact B an a helix separates two b sheets C two amphipathic a helices interact D two hydrophilic sides of b sheets interact 65 Chaperones are proteins which A use ATP to fold proteins B renature and denatured proteins C help cells repair damage due to heat shock D assist protein self assembly E All of the above

A translocation mutation is similar to except that it is between non homologous chromosomes nondisjunction A C crossing over B inversion D deletion

A The empty cell shown to the right will not be viable B X become a polar body XX X C be haploid

A The final phase of diagrammed to the right indicates CAZIN mitosis B binary fission X XX X C meiosis

Question 2 Points 1 Land use rules typically are decided by O state government O county government O townships and municipalities O mayors

Question 8 Points 2 Which of the following is NOT a basic aspect of communism OFree market O Central planning O Collectivization O State ownership

In gel electrophoresis the smaller DNA fragments move faster through the gel than the heavier fragments thus creating bands A True B False

Which of the following is NOT one of the functions of NK cells To read self antigens presented on somatic cells and determine them to be healthy and not to be killed by inducing apoptosis To read altered self antigens on somatic cells and determine them to be cancerous and to be killed by inducing apoptosis To read foreign antigens on somatic cells and determine them to be infected and to be killed by inducing apoptosis To read foreign antigens on somatic cells and destroy them via phagocytosis All of the above are functions of NK cells

Lacrosse 1 Lacrosse is considered a n 2 Lacrosse originates from which culture 3 Men s field lacrosse is played with game players on the field at once which ranges in sizes for positions

A third ssDNA same amount and same buffer is added in a new tube with the same 5000 nucleotide long single stranded DNA You repeat the same experiment and noticed that the forming of dsDNA starts immediately as soon as the cooling phase begins Curve 3 in the graph below dsDNA 100 Curve 3 Time Curve 1 Curve 2 Third ssDNA sequence TACGTACGTACGCGTACGTACGTA 2 Explain why this is happening with this last oligonucleotide but not with the first two

A mouse embryo is produced with only one chromosome 16 Assuming normal sperm contribution a chromosome separation error could have occurred in A meiosis I only giving rise to an egg with no chromosome 16 OB meiosis II only giving rise to an egg with no chromosome 16 OC meiosis II only giving rise to an egg with one chromosome 16 D Either meiosis I or II giving rise to an egg with no chromosome 16

Which statement about the chromosome structure is CORRECT OA The q arm of the acrocentric chromosomes has satellites OB The centromere is the terminal part of the p arm OC The Y chromosome does not have a short arm OD The q arm is the long arm OE The telomere is the central part of the chromosome

When during the cell cycle are chromosomes visible during Mitosis O only when they are being copied O only during the G1 phase O only during interphase

Procedure access 1 Go to the URL below follow the simulation http www biology arizona edu cell bio activities cell cycle cell cycle html 2 Complete the steps of simulation 3 Observe the 36 cells in the simulation and tally each of the stages on a separate piece of paper and fill in your results in Table 1 and tally e

Procedure 1 Obtain an onion root tip and whitefish slide from the slide holder and place your slide on the microscope stage 2 Observe the onion root tip under low power Cells at the very tip of an onion are not dividing therefore focus on the cells just behind the tip known as the zone of cell division 3 Observe the whitefish slide Compare the difference of mitosis between the onion and whitefish Compare the similarities and differences 4 Once you have located the zone of cell division increase the power of magnification until you can clearly see individual cells Try to locate cells from each stage of mitosis and draw below for each slide Onion Root Tip Prophase Metaphase Anaphase 7 Telophase

What is happening in the illustration below Read all answer choices before answering Both recombination and separation of sister chromatids Chromosomal recombination Both recombination and segregation of homologs Segregation of sister chromatids Segregation of homologous chromosomes

When do daughter cells have the same karyotype as the parent cell they came from After meiosis II After mitosis After meiosis I After mitosis and after meiosis I

After Meiosis I a typical animal cell is haploid with two copies of each homolog 1N 2X diploid with one copy of each homolog 2N 1X haploid with one copy of each homolog 1N 1X diploid with two copies of each homolog 2N 2X

What process es is are illustrated in the images below Apoptosis Meiosis II Either meiosis I or mitosis Meiosis I Mitosis TH

Question 7 1 point What type of animal cells will be used for the expe Omonkey liver cells Odog tail stomach cells Ohuman cheek cells human lung cells

Part C Examining Two Base Pairs Base Pair Rise is the average distance between the planes of the two stacked base pairs The rise of the belix is The belix twist is One complete turn of the helix is 360 Predict the number of base pair planes for one complete turn Given the rise for a pair of base planes Predict the total height of a full turn A DNA 2548 32 70 7 40 00 B DNA 3 375 36 00 10 50 00

The term chromatin refers to Select one O a protein units composing the nuclear pore O b eukaryotic DNA molecules along with their associated proteins O c the small and large rRNA subunits O d eukaryotic RNA molecules along with their associated proteins