Cell Cycle and Cell Division Questions and Answers

Select ALL of the following that are TRUE regarding control of cell division The joining of specific cyclins and Cdks initiates the steps needed for cell division The G1 checkpoint ensures that all DNA is replicated and damaged DNA is repaired or else the cell cannot continue replicating When the area of the membrane becomes inadequate for nutrient exchange that acts as a Go signal for replication to occur The G2 M checkpoint is the most important checkpoint Cells that do not pass it exit the cell cycle and enter GO phase

Listen Match the event with the phase of mitosis that it occurs in The chromosomes decondense to form chromatin and the nuclear envelope begins to form The individual chromatids separate and move to opposite poles of the cell The DNA condenses into chromosomes and the nuclear envelope disappears The microtubules of the mitotic spindle align the chromosomes in the center of the coll 1 Anaphase 2 Metaphase 3 Prophase 4 Telophase

What does it mean to be double negative Double positive Fo Curliest Thy mocyte Stage Double nagetire both CD4 CD8 Double positive includer CD

4 Listen What type of spore producing structures do molds like Penicillium f Obuds basidia sporangia conidiophores asci

Normal cells exhibit contact inhibition and will stop dividing when they touch other cells cancerous cells continue dividing and may grow on top of each other True False

DNA replication occurs during which phase of the cell cycle Prophase of Mitosis S phase of Interphase R phase of Interphase Metanhase of Mitocic

A Centrioles B Cleavage furrow OC Mitotic spindle OD Kinetochore microfilaments Question 2 1 point Listen This membranous organelle resembles a stack of flattened sacs with bulbous ends and associated vesicles OA smooth endoplasmic reticulum B Golgi apparatus C lysosomes

8 Which of the four processes of Motivational Interviewing MI uses specific techniques to recognize and respond to the client s language that is in favor of change OO O Engaging Evoking Confronting

4 How does the Transtheoretical Model describe a person s movement through the Stages of Change O Moving in a fixed linear order Unlikely to return to previously addressed stages Frequently returning to prior stages Rarely moving past the preparation stage

Listen What structure is labeled as 4 13 4 9 6 7 5 8 10 11 3 12 2 1 wer 14 22 15 16 17 21 18 19 20

What mechanism ensures that motor proteins like myosin or kinesin move undirectionally along the cytoskeleton Motor proteins are attracted to the charged ends of cytoskeleton filaments Motor proteins are only active when bound to GTP O Some of the motor protein s conformational changes are tightly linked to ATP hydrolysis Motor proteins bind to the cytoskeleton and undergo random conformational changes

28 You are cleaning up a spill of a bacterium with bleach bleach kills 90 of this particular bacterium every five minutes If you start with let bleach sit on the spill for twenty minu and found at that point that only 50 bacteria are still alive what was your starting population Final population initial population x remainder population total time killing period Round your answer to a single significant digit for example 200 000 000

In some organisms cells can undergo mitosis without then undergoing cytokinesis This would produce O cells lacking nuclei Ocells that are unusually small Ocells with more than one nucleus destruction of chromoromor

Multicellular eukaryotes use mitosis and cytokinesis for what three key events Please choose all that apply Asexual reproduction Sexual reproduction Wound repair O Production of haploid gametes from diploid cells

Normal centromeres allow for sister chromatids to be held together following DNA replication but defective centromeres do not enable the spindle apparatus to attach properly Consider a cell with chromosomes with defective centromeres Checkpoint controls would stop these cells from dividing by stopping the cell cycle in O the S phase O cytokinesis Omitosis OG2 OG1

How many chromosomes chromatids and pairs of homologous chromosomes are shown in the image ES O 3 chromosomes 12 chromatids 6 pairs of homologous chromosomes O 6 chromosomes 12 chromatids 3 pairs of homologous chromosomes O 6 chromosomes 12 chromatids 6 pairs of homologous chromosomes O 6 chromosomes 6 chromatids 3 pairs of homologous chromosomes

During meiosis genetic variation is generated in the resulting gametes by and independent assortment cytokinesis separation of sister chromatids in anaphase I crossing over

Which of the following are true statements about chromosomes Please choose all that apply Homologous chromosomes are assigned the same chromosome number Homologous chromosomes must have the exact same alleles as each other Homologous chromosomes have the same types of genes as each other Homologous chromosomes are often very different lengths from each other

During which phase of mitosis does the nuclear envelope reform around the separated chromatids anaphase prophase O metaphase telophase

A cell in the G1 phase senses that there are limited nutrients in the surrounding environment What is the most likely outcome O The cell will continue into S phase until it runs out of resources O The cell will remain in G1 until the environment is favorable for cell division O The cell will undergo mitosis but not cytokinesis O The cell must undergo apoptosis at this stage if there are not enough nutrients to complete the cell cycle

Even in a population of actively dividing cells for example those involved in wound repair most cells spend the majority of their time in Oanaphase O telophase O interphase O prophase

terphase plays an important role in preparing a cell to divide Which of the following events takes place during interphase The cell copies its DNA and grows A B C D DNA and proteins condense into tightly coiled chromosomes Spindle fibers attach to each chromosome and align them along the cell equator Cytokinesis takes place dividing the cytoplasm between the two daughter cells

Which of the following is NOT a stage in the cell cycle A B C Gap 1 Gap 2 Development D Mitosis

How many haploid gametes are produced from one diploid cell during the process of meiosis A B C 1 2 3

During which phase of mitosis do the chromatids separate to opposite ends of the cell A B C Prophase Metaphase Anaphase

Two different kinds of cloning library are depicted in the left and right diagrams below chromosomal DNA gene A RNA transcripts mRNAs gene B RNA SPLICING TRANSCRIPTION REVERSE TRANSCRIPTION AND DNA CLONING cDNA clones in cDNA library a Name the library type depicted on the left 1 mark cDNA library b Name the library type depicted on the right 1 mark Genomic library gene A chromosomal D gene B exon intronnontranscribed DNA RESTRICTION NUCLEASE DIGESTION DNA fragments DNA CLONING

Adding solutes such as sugar and salt can inhibit microbial growth by lowering water activity O True O False

The figure below is linoleic acid a common fatty acid in sunflower oil H N M H H H H HK If drops of sunflower oil are placed into a beaker of water what is most likely to happen Hint the electronegativity value of carbon is 2 5 and the electronegativity value of hydrogen is a biologically similar 2 1 O O O The droplets of oil will not dissolve into the water and will aggregate with other oil droplets The droplets of oil will rapidly dissolve into the water The droplets of oil will accumulate in the center of the beaker of water and form a layer dividing the water in half I DON T KNOW YET

Which cell type is highlighted O umbrella cells O goblet cells O macula densa cells O simple squamous cells

The industrialization of the U S set in motion the establishment of a new version of the American family the modern family True False

lation of Meiosis Assume the cell that is dividing has 8 chromosomes he number of homologous pairs in the cell at each phase number of chromatids per chr er they are monads dyads or tetrads Number of homologous pairs Number of chromatids per Mchromosome Monads Dyads or Interphas Tetrads Meiosis I

What are 3 ways by which bacteria can overcome evade or avoid phagocytosis 3pts Your Answer

Looking at this karyotype what can be correctly stated XXXKXX YDY 10 11 13 19 14 20 15 16 17 21 22 18 this is a polygenic disorder Othere are 47 chromosomes this is an autosomal recessive disorder this is an autosomal dominant disorder

USE THE IMAGE BELOW TO ANSWER QUES As you can see the cell in interphase has been labeled for you Phases of the Cell Cycle MRAN B A C Interphase 26 What is the correct order for the following phases of the cell cycle a Interphase A B C D b Interphase A C D B c Interphase A D C B d Interphase B D C A D 27 During which phase do the chromosomes line up in the middle of the cell a Metaphase b Telophase c Prophase d Anaphase 28 An individual who has two dominant alleles BB for a certain gene is called a Homozygous Recessive b Homozygous Dominant c Heterozygous Dominant d Heterozygous 29 Which of the following is an example of a heterozygous genotype a Bb b BB c bb d None of the above

3 Explain your prediction for the effect Na Cl might have on glucose transport In other words explain why you picked the choice that you did How well did the results compare with your prediction Recall that during the experiment you were asked What effect do you think adding Na Cl will have on the glucose transport rate You answered The glucose transport rate will decrease

2 Simulation of Melosis Assume the cell that is dividing has 8 chromosomes 1 List the number of homologous pairs in the cell at each phase number of chromatids per chromosome and whether they are monads dyads or tetrads Number of homologous pairs 8 Number of chromatids per Mchromosome Monads Dyads or Interphase Tetrads Meiosis I or II

Which tube is showing the growth of facultative anaerobes

Which of the following is an accurate statement about the phases of mitosis O O O O Interphase is the first phase mitosis During prophase chromos align in the middle waiting separate During metaphase only chromatin is present During anaphase chromos begin to separate I DON T KNOW YET

What is structure 27 on the drawing below DEBRE ectoderm endoderm blastopore blastocoel 25 26 hollow space 27 28 29 hole hollow space

genes are shown below first letter G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG U leucine phenylalanine leucine isoleucine START Normal TACCTCGTGGACTGAGGTCTC valine Mutated TACCTCGTGGACTGAGGTCAC RNA Codon Table second letter methionine An RNA codon chart UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG C serine proline threonine alanine UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AMA AAG GAU GAC GAA GAG A tyrosine STOP histidine glutamine asparagine lysine aspartic acid glutamic acid UGU UGC UGA STOP UGG tryptophan CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG cysteine arginine serine arginine glycine U C A G U A G third letter

Friedreich s ataxia is an inherited disorder that is caused by an insertion mutation in a non coding portion of the FXN gene where a GAA triplet is repeated hundreds of times The FXN gene codes for the protein frataxin A pedigree of a family with members affected by this disorder is shown in the image below 0 2 A 11 B C IV A pedigree of a family affected by Friedreich s ataxia unaffected male unaffected female 7 Based on the pedigree above which of the following is the inheritance pattern of Friedreich s ataxia autosomal dominant 3 Cote 8 9 10 6 5 autosomal recessive sex linked recessive 4 affected male affected female

Which is true about genetic disorders A Gene therapy is an area study that could eventually fix the disorders B Genetic disorders are curable C Genetic disorders can never be treated D There are no therapies available to help symptoms A

Which of these describes the genetic material of cells produced by mitosis Select all that apply New cells are genetically identical to the original cell New cells have the same number of chromosomes as the original cell New cells have half the number of chromosomes as the original cell New cells have the same number of chromosomes as the original cell but have different genes MO POSSIBL

Figure 15 13 Dinoflagellates Dinoflagellates such as Gonyaulax have cellulose plates cellulose plate flagella Dinoflagellates supergroup Chromalveolata are photosynthetic but they have two flagella one is free but the other is located in a transverse groove that encircles the animal The beating of these flagella causes the organism to spin like a top The cell wall when present is frequently divided into closely joined polygo nal plates of cellulose At times there are so many of these organisms in the ocean that they cause a condition called red tide The toxins given off in these red tides cause widespread fish kills and can cause paralysis in humans who eat shellfishes that have fed on the dinoflagellates Heterotrophic Protists The term protozoan refers to single celled eukaryotes and its use is often restricted to heterotrophic orgar isms that ingest food by forming food vacuoles Other vacuoles such as contractile vacuoles that rid the cell of excess water are also typical Usually protozoans have some form of locomotion and as shown in Figure 15 14 some use pseudopodia some move by cilia and some use flagella Plasmodium vivax which causes a common form of malaria is an apicomplexan Apicomplexans have special organelles one is an apicomplast at the base of their flagella and the other contains organic chemicals that assist in penetrating host tissues Plasmodium spends a portion of its life cycle in mosquitoes sexual phase and the other part in human hosts asexual phase During the asexual phase of their life cycle all apicomplexans exist as particulate spores which accounts for why they are also called sporozoans In general how do sporozoans differ from the other protozoans shown in Figure 15 14 Plasmodium spores are the cause of malaria they multiply in and rupture red blood cells

A retrovirus such as HIV is able to work backwards using to copy its own RNA into DNA in its human host A DNA polymerase III B RNA polymerase I C reverse transcriptase D RuBisCo

is added to start of the unmodified RNA to act as protection preventing information loss A 3 GTP cap B The exon C 5 GTP cap D The poly A tail

Which the following is NOT true regarding ribosomes A they are organelles B synthesize proteins C they attach to tRNA D contain highly folded rRNA

A In this DNA fingerprint the crime scene CS DNA matches which suspect most closely 2 B 1 C CS 1 2 3 3

The term semelparity a best describes an organism who only produces offspring twice during their lifetime b best describes an organism who only produces offspring once in their lifetime c refers to an organism with a Type I survivorship curve d best describes an organism who repeatedly produces offspring over the course of their lifetime

Identify which of the following cells are myeloid and which are lymphod neutrophils NK cells basophils B cells macrophages T cells A myeloid B lymphoi