Cell: The Unit of Life Questions and Answers

Two copies of the same chromosome in a cell are called alleles centromeres chromatids homologues

When doing the streak plate how many times should you get bacteria from the tube once before you make the last streak O many times get bacteria before making every streak once before you make the 1st streak set of zigzags zorro signs Otwice get bacteria before making the 1st and last streaks

s point A secondary plant compound might b used for which of the following O a new drug O O a soil nutrient a new crop variety a crop pest

Which three features are found in both plant and animal cells A a plasma membrane a capsule Golgi apparatuses cytoplasm mitochondria ribosomes a rough endoplasmic reticulum a nucleoid centriofes plastids cytoplasm nucleus B C D

B C The chart below shows codons found in Messenger RNA Second Base C A G Sor Tyr Cys Sor Tyr Cys Ser Stop Stop Sor Stop Trp First Base A A G U Lou Lou Lou Lou lle llo lle Met Val Val Lou Lou Val Val U Pho Pho Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala His His Gin Gin Asn Asn Lys Lys Asp Asp Glu Glu lys ser lys ser lys arg lys arg ser lys ser lys Arg Arg Arg Arg arg ser arg ser Ser Ser Arg Arg A strand of mRNA containing the repeating sequence AAGUCCAAGUCC could code for which of the following amino acid sequen Gly Gly Gly Gly DO O DO O DURO DURG G A Third Base G

20 If an organism has successful variations what usually occurs 21 The long neck of a giraffe is the result of natural selection Explain this 22 How did life begin on earth simple to complex or complex to simple 23 How is our evolutionary model like a tree

55 Which statement s apply to urea A highly soluble in water 56 B major solute in urine of mammals C produced in the liver D compound used as a means of removing excess nitrogen E All of the above is hydrolytically cleaved to directly yield urea in the urea cycle A Carbamoyl phosphate B Ornithine C Glutamate D Arginine 55 56

48 a ketoglutarate is a precursor for each of the following except B glutamine A proline C arginine 49 An amino acid formed by transamination of a citric acid cycle intermediate is B cysteine C alanine A aspartate D glycine D serine 48 49

The velocity time graph of a lion is given below Velocity in m s Time in seconds Which of the following statements best describes the graph O The acceleration of the lion decreases with increase in time O The acceleration of the lion increases with increase in time The acceleration of the lion in

Match the events of phagocyt 6 P

Question 4 Socialist countries use all but which of these policies to achieve their goals Points 3 Nationalization of key industries O Broadening of public services O A centrally planned economy O A prohibition of any taxation

Question 10 The body cells of elephant have 56chromosomes If an elephant skin cell with 56 chromosomes divides by mitosis each daughter cell will have 05 chromosome

Which of the following correctly describes the pathway taken by a protein destined for secretion from an animal cell O rough ER transport vesicle plasma membrane golgi O plasma membrane transport vesicle rough ER transport vesicle Golgi O rough ER transport vesicle Golgi transport vesicle plasma membrane O Golgi rough ER nucleus plasma membrane

Which of these pairs of organelles is responsible for energy conversion mitochondrion and chloroplast vacuole and ribosome golgi and endoplasmic reticulum centriole and ribosome

What kind of enzyme catalyzes the removal of a single nucleotide from the end of a nucleic acid chain Exonuclease Polymerase Ligase Endonuclease

Which class of antibodies is only expressed as BCRs before class switching and is not secreted as soluble antibody IgA IgG IgM IgD

The mitochondria and chloroplasts are distinct from other organelles in the cell because they have A Their own genome B Membrane embedded proteins OC Lipid bilayer membrane D Distinct glycolytic pathways

The sequence below represents the coding strand also called the nontemplate strand of a gene from a rapidly mutating virus starting with the sequence that encodes the translation initiation codon 5 ATGGCGACTATCGTTAAGTA 3 You have isolated a mutant version of this gene that contains three base pair changes underlined below 5 ATGGCCACTATAGTTTAGTA 3 This combination of mutations will result in Codon table for reference First Letter U G U UUU UCU UUC UCC UUA UCA UUG UCG CUU CCU CUC CCC CUA CCA CUG CCG AUU ACU AUC lle ACC AUA ACA AUG Met Start ACG GUU GCU GCC GCA GCG GUC GUA GUG Phe Leu Leu Val C Second Letter Ser Pro Thr Ala A UAU UAC UAA Stop UAG Stop CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr His Gin Asn Lys Asp Glu G UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly MCACU O ADO A U Third Letter A substitution of only one amino acid in the polypeptide product OB substitution of multiple amino acids in the polypeptide product OC a shorter mRNA transcript OD a shorter polypeptide product

The photograph below shows a single replicated chromosome consisting of two sister chromatids just before mitosis This chromosome contains centromere A two single stranded DNA molecules OB one double stranded DNA molecule OC two double stranded DNA molecules OD many double stranded DNA molecules

In addition to ATP what are the end products of glycolysis CO and H O Olactic acid and citric acid CO2 and ethyl alcohol Pyruvate and NADH

Do not have defined organelles Has a nucleus Has defined organelles Question 7 1 point Listen What type of animal cells will be used for the experiment monkey liver cells cells

The function of the nucleolus is to manufacture polypeptides to manufacture ribosomal RNA intracellular digestion to store chromatin

A bacterial ribosome contains A 30S subunit composed of 16S rRNA A 30S subunit composed of 5S and 23S rRNA A 50S subunit composed of 16S rRNA X A 70S subunit composed of 5S and 23S rRNA

7 A thesaurus is primarily used to look up OA synonyms O B definitions O C spelling O D pronunciations

6 Samuel is so blunt that he always says exactly what he is thinking What is the meaning of the word blunt in this sentence O A Boring O B Careless O C Direct O D Dull

The functions of the cell Check All That Apply Helping to determine the shape of a bacterial cell Preventing rupture of the cell from increased internal pressure Allowing the cell to regulate the transport of many molecules from the internal to external environment Allowing the cell to reproduce sexually Providing the cell with a means of motility movement

Which statement is not true of mitochondria and chloroplasts Select one O a Ribosomes are present in both mitochondria and chloroplasts O b Both mitochondria and chloroplasts contain DNA O C Mitochondria are only found in animal cells and chloroplasts are only found in plar Od They grow and divide independently in the cell Clear my choice

What is one function of kinesin in the cell Select one O a Moves vesicles along dynein O b Moves vesicles along microtubules O c Interacts with actin filaments to create skeletal muscle contractio O d Transports organelles along actin filaments microfilaments

A cell that was making a lot of protein for export would be expected to have relatively large amounts of Select one O a Smooth ER O b Rough ER O c Peroxisomes O d Lysosomes

Macmillan Learning 100 B DX A Denaturation 50 0 75 80 85 90 95 100 105 110 115 120 125 Temperature C What is the tm of the most GC rich DNA sample Answer Bank AT rich DNA GC rich DNA

Step A HAVE Step B lle Mat HE 12 12 Step C results in the production of 202 Step C 14 12 12 88 0 1 four zygotes that will develop into embryos 2 embryonic cells that could unite and develop into an organism four cells that will recombine to form two offspring 4 gametes that could be involved in the formation of a zygote Which processes lead to the greatest variety of genetic combinations

27 The transfer of genes from parents to their offspring is known as 1 differentiation 3 immunity 2 heredity 4 evolution 28 The sequence of events occurring in the life cycle of a bacterium is li A The bacterium copies its single chromosome B The copies of the chromosome attach to the cell membrane of the bacteriu C As the cell grows the two copies of the chromosome separate D The cell is separated by a wall into equal halves E Each new cell has one copy of the chromosome

0 D O tryptophan O NONE OF THESE stop O ALL OF THESE Question 10 OGTP O streptomycin O methionine O ATP Otetracycline Question 11 interferes with the binding of formylmethionyl tRNAs to the small ribosomal subunit The ideal balance between speed and accuracy during translation results in insertion of an incorrect amino acid in a protein with a frequency of O 10 10 4 10 5

O clathrin coated vesicles O ALL OF THESE O NONE OF THESE O nucleosomes O transmembrane proteins Question 3 O N formylmethionine O the translation start site methionine is the first amino acid in eukaryotic translation O AUG

5um Which of the following best describes the flagellar morphology displayed

UESTION 5 cate whether the statement belov

1 For different antibodies in the same class which structure s to the antibodies will be different and which will stay the same For the different antibody classes which structure s to the antibodies will be different and which will stay the same if any

The tRNAS serve as the adaptor molecules between the mRNA template and the growing polypeptide chain and are transcriGENES AND PROTEINS cust O RNA polymerase II RNA polymerase I RNA polymerase III HITT DA 644 75 DITT B 1250 QUESTIONS 29 5 4774 QUESTION 20

Over the years bacteria have become less sensitive to antibiotics used for medicinal and sanitation purposes This lack of sensitivity is termed antibiotic resistance How is antibiotic resistance an adaptation OA Antibiotic resistance has caused antibiotics to become more specialized thus adapting the antibiotics to particular bacteria species OB OC The trait giving bacteria antibiotic resistance has become common giving bacteria with the trait a selective advantage Antibiotic resistance makes it more difficult for bacteria to infect hosts thus is a selective advantage for the host OD The trait giving bacteria antibiotic resistance has reproductively isolated groups of bacteria

Gmail D2L Brightspace G Assignment i bok Staphylococcal Identification Tests Please label the image to examine the tests used to distinguish Staphylococcus aureus Coagulase positive Other Staphylococcus species Streptococcus species Coagulase negative

Osmosis is the diffusion of water across a selectively permeable membrane in which water moves from a solution containing a low concentration of solute to what kind of solution O A OB O C OD a solution containing a high concentration of water a solution containing a high concentration of solute a solution containing the same amount of solute a solution containing only the solute

Cell membranes plasma membranes help organisms maintain homeostasis by controlling what substances may enter or leave cells Some substances can cross a cell membrane through passive transport while other substances can only cross a cell membrane through active transport What is the difference between active and passive cellular transport OA Active transport requires the cell to expend energy while passive transport does not Passive transport is the only form of transport that requires the use of protein carriers Active transport is the only form of transport that requires the use of protein carriers OD Active transport requires the cell to form vesicles while passive transport is done through osmosis OB O C

During which phase of mitosis do the very specific kinetochores begin to attach to their respective chromosomes A anaphase B telophase C prometaphase D prophase

Cell division in eukaryotes is more complicated than prokaryotes due to the presence of a encasing the DNA

Question Completion Status 10 33 20 30 20 34 35 36 5 QUESTION 49 60 70 39 40 80 90 100 110 120 130 14 150 16 41 42 43 44 45 46 47 48 49 50 L 38 nat shape O one big polar head with one long nonpolar tail 17 18 19 200 210 A 62 year old Caucasian male develops episodes of incoordination and slurred speech His wife notes that he seems depressed and argumantative His physician diagnoses multiple sclerosis which is best described as which of the following O Demyelinating disease with loss of triacylglycerols from the brain and spinal chords O Demyelinating disease with loss of cephalin from the brain and spinal chords O Demyelinating disease with loss of sphingomyelin from the brain and spinal chords O Lipid storage disease with accumulation of triacylglycerols in the brain hs

characteristic of life which involves cell division but does not necessarily have to result in offspring A Adaptation B Energy use C Reproduction 2 Locomotion

A When a signal is transduced by a cell its interpretation is rapid or errors may occur B can be mistaken C is clear and concise

How many nucleotides code for 1 amino acid

osome Which cellular organelle is responsible for manufacturing ATP Chloroplast Mitochondria Nucleus

hat is the name of the organelle in the leaves of plants that absorbs the Sun s energy stomata chlorophyll roots chloroplast