Ecology - General Questions and Answers

Which rock unit is oldest The Cold Canyon area Revelstoke Fm Kamploop GE Osoyoos Lake Limestone Penticton Fm Okanagan Fm Thompson River Fm Revelstoke Fr C E D Granite Copper Creek Fm Contact metamorphosed zone Copper Creek Fm A Abbotsford Fim

Which statement s or characteristic s is are not true for the plantlike protists algae Circle all correct answers a They are a diverse group that includes diatoms to multicellular kelp b They are photoautotrophs c They have chlorophyll a and membrane bound plastids d Examples include Spirogyra Volvox Polysiphonia and Euglena e They do not undergo conjugation

How have the protists traditionally been classified

6 Where on the cell are the conjugating Paramecium caudatum joined

5 Briefly describe the purpose of conjugation in paramecia

4 Describe the action of the contractile vacuole of the Paramecium in a hypotonic solution

4 12pts A research study published in The Journal of Biological Chemistry 2020 and mentioned in Science Daily 2020 discusses a drug that has been used in the treatment of SARS and MERS type coronaviruses Recent clinical trials were conducted by the NIH at the University of Nebraska Medical Center UNMC which is about 80 miles northeast of Doane University to test for its effectiveness towards combating the novel coronavirus COVID 19 Refer to the articles posted in module 4 and other resources you have at your disposal to answer the following questions Answer each part below accordingly a 1pt What is the name of the drug discussed b i 1pt Look up ie google and draw the structure of this drug ii 1pt How many carbon atoms in this structure are considered chiral c i 1pt What is the configuration of the chiral carbon which is not part of a ring Circle the correct label R or S below ii Using the structure drawn above label the priorities according to Cahn Ingold Prelog rules 1pt R or S d i 1pt How many additional stereoisomers does this compound have Note the phosphorous in this structure is also a stereocenter ii 2pts Propose a reason why the stereochemistry of this drug is important e 2pt What biochemical enzyme has this drug been shown to inhibit and why is this important f 2pt Draw the structure and provide a name of the RNA nucleotide that this drug most closely resembles

is your culture s social psychological and behavioral expectations related to the sex you were assigned at birth Sex Gender Sexual orientation Culture

Prisha has just moved with her father from India to Paris She is having difficulty fitting in at school and finds herself not wanting to speak French or do traditional French things with classmates She has made friends with an elderly Indian woman who lives next door to her and spends all of her time with her talking in Hindi about her previous life in India What type of acculturation strategy is Prisha using O assimilation separation Omarginalization O integration

You want to better understand a coworker s culture In order to avoid stereotyping your coworker it would be best to make sure that you O consider only what is typical for your coworker s culture consider that everyone including your coworker is unique and that culture is irrelevant consider what is typical for your coworker s culture but also that your coworker might not be typical for that culture consider what is atypical for your coworker s culture and that your coworker might be typical for that culture

Macmillan Learning You live in a culture that is open to various viewpoints and requires few laws or social guidelines to dictate and control behaviors This type of culture is high in avoidance of uncertainty long term orientation acceptance of uncertainty short term orientation

is when a person who is transgender lives a life as the gender that matches their identity rather than their biologically assigned gender based on their sex Adapting Assimilating O Transitioning Transgendering

Cow of the Future Case Study Part 2 continued G1 a Fxn promoter b how many for pmoCAB transcription G2 a Fxn of initiation and termination sequences b how many mRNA molecules produced from pmoCAB G3 a Fxn RBS b How many RBS when pmo is transcribed Figure 3 Depiction of the pmo operon G4 a Fxn start stop codons b How many start stop codons on RNA transcribed from pmoCAB a b C pmoC def pmoA ghi pmoB k 1 G5 Which letter represents were the RNAP would bind to transcribe pmoCAB as a unit G6 Which area s marks where you would find initiation site s m G7 Which area s marks where you would find termination site s G8 a Which area s marks where you would find translational start site s b Which area s marks where you would find translational stop site s G9 Which letter indicates the 5 end

ere 3 synthesis estrial ke Plant respiration Plant biomass 550 Soil carbon 60 Fossil fuels cement and land use change Microbial respiration and decomposition Fossil pool 10 000 Atmospheric Carbon Net Annual Increase 90 2 Phytoplankton photosynthesis Air sea gas exchange of carbon year Numbers in parentheses refer to stored carbon pools Red indicates carbon from human Q Net ocean uptake 2 6000 90 Reactive sediments Surface ocean 1000 Respiration and decomposition Deep ocean 37 000 Observe the labels in the diagram What is similar and different between the terrestrial and aquatic ecosystems in this Figurer Observe the number values in the diagram What is similar and different between the terrestrial and aquatic ecosystems in this Figure Why do these differences exist Be specific in your explanation Using the quantitative data on the diagram explain how the ecosystem is attempting to maintain homeostasis Include the numbers in your explanation Terrestrial Aquatic Using the quantitative data on the diagram explain how the net gain of atmospheric carbon from human emissions impacts these ecosystems Terrestrial Aquatic Using the quantitative data on the diagram explain how you know whether the attempt to maintain homeostasis has been successful or not

Predict if the lipid below will give a positive result to the tests below Then indicate the portion or the structure that contributes to the positive result for its corresponding test CH O C CH2 16CH3 CH O C CH2 CH CHCH CH CH CH2 CH3 0 CH CH N CH3 3 CH2 O Test A Liebermann Burchard Test B Test for Phosphate O Yes or No Test D Molisch Test E Kraut s Test Yes or No

The Cambrian explosion is best known from the Burgess Shale a fossil locality in O Minnesota USA O Warrawoona Australia O Yucatan Mexico British Columbia

Match the eating strategy with the correct description filter feeder predator detritivore Choose eating food particles from the seafloom processing water for particles of food eating another metazoan Choose

In a tropical environment what might be different The quartz would have decomposed to clays The feldspar would have decomposed to clays Both quartz and feldspar would have decomposed to clays Nothing would be different

Now familiarize yourself with the library s webpage by following the instructions below a Go to the library webpage https library csub edu b In the search box type in Ecology This search will pull up all titles with the name Ecology c Find the link for Ecology Brooklyn New York N Y that is available at CSUB Library Periodicals Collection Level 2 i Is this resource a book or a journal This resource is a Journal ii From what years is Ecology available in hard copy in the library CSUB Library Periodicals Collection iii How many online databases do we have full text access to for Ecology iv Click on the JSTOR Life Sciences database What was the last year this database has for this journal v Do we have full text access to this journal past 2017

SLIDE 5 14 Identify the structures labeled A 15 Identify the structure labeled B 16 Identify the tissue labeled C 17 Which layer of the skin is this hint what structures do you see that can help you decide C

Given the following three mRNA sequences determine which two code for the same protein Circle these two anscript anslate mRNA 1 mRNA 2 mRNA 3 AGU UUA GCA ACG AGA UCA UCG CUA GCG ACC AGU UCA AGC CUC GCC ACU CGU AGU

Regarding the MNS blood group which point is correct O Anti M and anti s are a cause of HTRS O Anti M and anti S are lgG O Anti s and anti S are a cause HTR O None is correct O Anti M Ant N Anti S and Anti s are a cause HTR

Master mix 1 GFP pUC19 F 5 CCAGGCTTTACACTTTATGCTTCC 3 GFP PUC19 R 5 CTTTGATTCCATTCTTTTGTTTGTCTGCC 3 Master mix 2 GFP PBR322 F 5 GATGACGATGAGCGCATTGTTA 3 GFP PBR322 R 5 CTTTGATTCCATTCTTTTGTTTGTCTGCC 3 Reagents Sterile water Taq buffer dNTPs Forward primer Reverse primer Bacterial DNA Taq polymerase Stock concentration 10X 2mM 2 M 2 M Final concentration 1X 0 2mM 0 2 M 0 2 M Final volume Volume L 1 reaction 2 L 1 L 20 L 7 reactions 126 L Question Fill in the required volumes for the PCR table above 6 Place your labelled PCR tubes in the PCR machine closest to you Once you and the group opposite you have loaded your tubes into the machine program the following conditions

Identity Cultural Narrative 10 pts For this first writing assignment students will reflect on how race ethnicity language culture gender sex and sexuality have shaped their identity Some essential questions to stimulate student s intellectual curiosity Personal Identity How do you define your identity and What aspects of your identity do you feel most connected to Cultural Background What cultural traditions or practices are significant to you and community Language and Communication How does language play a role in your identity and How do you navigate communication in socially and linguistically diverse settings Social Justice and Advocacy Are there social justice issues that align with your social locations race class gender and sexuality to name some and How do you engage in advocacy for historically marginalized communities Writing expectations and conventions This assignment must be two pages long double spaced with one inch margins and typed using 12 font Times New Roman Please ensure you follow the above formatting instructions outlined in this assignment Please proofread for writing challenges grammar punctuation and NED 00107

List the geologic layers in order from oldest to youngest R B H BIU E M I H R M FS

1 You are given a mixture containing two compounds A and B Both compounds have a solubility of 1 00 g 100 mL of solvent at 20 C and 12 0 g 100 mL of solvent at 100 C The sample is composed of 1 60 g of A and 9 90 g of B At 100 C all of the sample just dissolves in a minimum amount of solvent The solution is then cooled to 20 C and the crystals are collected a What is the composition of the crystals B b What is the percent yield of the process Yield c What is the composition of the mother liquor A B 2 If the mixture described in question 1 are recrystallized from 100 mL of solvent instead of the minimum amount a What is the composition of the crystals

following the instructions below a Go to the library webpage https library csub edu b In the search box type in Ecology This search will pull up all titles with the name Ecology c Find the link for Ecology Brooklyn New York N Y that is available at CSUB Library Periodicals Collection Level 2 i Is this resource a book or a journal ii From what years is Ecology available in hard copy in the library CSUB Library Periodicals Collection iii How many online databases do we have full text access to for Ecology iv Click on the JSTOR Life Sciences database What was the last year this database has for this journal v Do we have full text access to this journal past 2017

Prior to conducting any scientific investigation you need to learn as much as you possibly can about the biology of the organism in question To learn about the biology of an organism you would first consult textbooks and scientific journal articles to learn what is known about the organism This knowledge can give you a starting point for your research and provide direction of how to address your questions For some organisms c g fruit fly Drosophila melanogaster there is a large body of literature that covers everything from behavior and ecology to physiology and anatomy to genetics and evolution For other organisms much less is known This semester you will be asked to conduct scientific investigations on your own You will conduct an experiment collect and analyze data and report your findings in the form of a scientific research paper The first few labs are designed to provide you with the tools to complete these assignments The first step however will be to familiarize yourself with locating reading and interpreting scientific literature As a scientist it is very important to not only use these resources to help you with your experimental design and background on your research topic but also to communicate your own results If I conduct research in my lab but never tell anyone about it guess what It is like it never happened So I must communicate my findings to other scientists This is most often done in the form of peer reviewed scientific articles The goal of this exercise is to learn about a few of the resources available to you for finding scientific literature and to familiarize yourself with the various ways in which scientific articles are formatted each one is different Type your answers below each question or as instructed by the question Your answers should be color coded either blue red or purple to make your response obvious to your instructor Each response blank space is worth 0 5 pts for a total of 10 pts 1 There are two types of resources that can be used and are helpful Please do a Google search and define each of the terms below a Primary Literature

Listen ease explain what is occurring in a chemical reaction What are the names of th rting materials and end materials involved in any chemical reaction

BI 6 888 DOOM1111 PCR Amplification DNA extracted from tissue DNA fragments move across the gel DNA sample loaded into wells Electricity applied to the gel 5 7 Why is DNA fingerprinting called a fingerprint a All of a person s DNA is found in their fingers b A person s DNA fingerprint looks the same as a person s physical fingerprint C Everyone s fingerprints is unique just as everyone s DNA fingerprint is unique d The tool used to make a DNA fingerprint is called The DNA Fingerprint Machine c Separate the DNA pieces by size d Compare DNA fingerprints find a match 2 8 What is the first step to making a DNA fingerprint a Cut the DNA into different sized pieces using restriction enzymes b Obtain a sample of DNA and make copies c Separate the DNA pieces by size d Compare DNA fingerprints find a match 9 What is the second step to making a DNA fingerprint a Cut the DNA into different sized pieces using restriction enzymes b Obtain a sample of DNA and make copies

The oxygen revolution the transition from anoxic to oxic conditions on earth took place abruptly over just a few million years True False

Dissolved iron Fe free and unreacted was abundant in the Archean oceans What were the main sources of the Fe rain weathering of continental rocks meteors stromatolites

Which sequence shows the steps of the process of s might occur experiment conclusion exploration application question observation experiment analysis prediction exploration hypothesis prediction experiment oration question opinion conclusion hypothesis

As a measure of your participation you will write 200 word minimum responses to the readings as well as responding to at least one other post In these posts I want to see concrete examples where you critically reflect on the readings This can include citing specific photographs and photographers theoretical connections between different readings ideas themes and or the author s own argument Please refer to my separate guide on discussion posts for full details

Choose the correct answer The cytoskeleton of a cell can generate movements via structures such as contractile ring or flagella Which cytoskeletal elements are linked with these two structures Select one a microfilaments and microtubules respectively b microtubules and intermediate filaments respectively c intermediate filaments and microtubules respectively d microfilaments and intermediate filaments respectively

Place the viral infection steps in the correct order Entry Assembly Synthesis Release

True or False Only enveloped viruses may have glycoproteins True False Question 8 2 points Listen For Ebola which of the following genes would be considered non structural VP40 SGP ONP

When DNA sequences are used for phylogenetic analyses each nucleotide position can be considered a trait Using the data provided below 57 bases from the mitochondrial DNA sequences of three chameleons and one lizard map ONLY the synapomorphic traits onto the phylogenetic tree provided below Note the horizontal branch on the tree where each trait transition takes place by using a line and the number of the base base numbers can be determined using the 10 50 marks above the sequence As an example of how I want you to map the traits onto the tree I have chosen a trait that is NOT synapomorphic and mapped it onto the tree position 10 the trait in question is an A in the lizard and two species of Brookesia and transitions to G in Chamaeleo After mapping all of the synapomorphic traits count the total number of trait transitions required to support this tree and note this number next to your tree If you are not sure which traits are synapomorphic read the material in the tan box that starts on page 214 of the text and is entitled Phylogenies from DNA sequences NOTE the tree only shows the three chameleon species leaving out the lizard Uromastyx outgroup that is included in the DNA data so you can evaluate which base is ancestral for each position Uromastyx B theili B brygooi C feae 10 20 30 40 50 AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT Brookesia theili Brookesia brygooi

Choose the correct sequence of events in the evolution of the cell Not all steps are included O self replicating RNA RNA in protenoid spherules DNA replaces RNA O self replicating DNA DNA in protenoid spherules RNA replaces DNA O self replicating RNA DNA replaces RNA DNA in protenoid spherules

Walter Cannon Per Scholander Knut Schmidt Neilsen George Somero Question 3 1 p If a scientist was interested in how nitrogen was extracted and sequestered within species their research would be classified as dar physiology

depends on the expression of the genetic sequence True False Question 8 1 pts Evolution is always adaptive leading to greater reproductive success of individuals and changes in the population True

Oxytocin is a hormone that causes uterine contractions during childbirth It is released from the anterior pituitary under the regulation of GnRH gonadotropic releasing hormone from the hypothalamus circulates to the uterus and causes uterine contraction If the baby is not ejected parturition rising estrogen levels feed back to the hypothalamus to cause the release of more GnRH which targets the anterior pituitary to release more oxytocin i e labor contractions This system is an example of negative feedback positive feedback homeostasis polyphenism ernst

Figure 1 Landscape

X70 Figure 1 Landscape

The figure below from a geologic publication from the early 1800s shows two sequences of sedimentary layers that are correlated to one another layers of the same age are matched Each fossil amminoid species shown to the right of the layers or strata is unique to the rock stratum layer in which it s found and together the fossils form a unique order through the layers of rock This observation as applied to correlating rock strata from different localities as shown here with the two sequences is the principle of O original horizontality O uniformitarianism O faunal succession O superposition O inclusions Fuller s Earth The Scruff Zigzag Bed Microzoa Beds Massive Beds The Red Bed Bridport Sands 888888 12 30 888 Pom Ostrea acuminata Parkinsonia parkinsoni Stephanoceras humphriesianum Ludwigia murchisonae

Molten lava that erupted from a volcano and then cooled is an example of O an igneous rock a metamorphic rock O a chemical sedimentary rock O a detrital sedimentary rock

Check All That Apply open flames infectous agents corrosive chemicals sharps instruments laptop microscope

oup prior to an exam attempting to gain academic credit in an unfair deceitful or fraudulent way Unauthorized use of information materials and sources when completing academic activities 1 point Match the factors for cheating with an appropriate example Excuse making Performance anxiety Unfamiliarity with what constitutes cheating Peer pressure Self justification habits Inability to manage demands of student life D Cheating because social and a v 21 1 Cheating is a broad term that encompasses many different ways that a student might attempt to gain academic credit in a way that is unfair deceitful or fraudulent Every semester at CSUB the Dean of Students receives reports from professors who have caught students attempting to cheat in one form or another Both professors and students are responsible for upholding the reputation of the university Cheating is often purposeful in nature but an unawareness of course or university policies and assignment requirements could also create confusion about what is and is not allowed Regardless of intention cheating can never be justified especially once you have learned the ways that it can negatively impact your college career and life outside the university Stay on the right path Know course policies on assignments collaboration exams Check the Syllabus If ethical dilemmas arise seek advice from trusted faculty or staff on campus on how you should deal with it Protect yourself It is your responsibility to clarify when collaboration is allowed and when it is not Different cultures and educational systems can vary in how information is used and credited Reach out to your instructors early to avoid misunderstandings

1 point Cheating is justified if the professor has unfair or difficult questions on an exam True False 1 point Which of the following is an example of cheating Sharing notes with a friend who missed class that day Return Checking your smartwatch or phone for answers during a test or texting a friend for answers 1 point Which of the following are consequences of cheating Clarifying with your instructor whether or not you can use outside sources during an exam Asking a friend what citation format they ll be using for the final paper 4 Submit for their future careers Da fraudulent Every semester at CSUB the Dean of Students receives reports from professors who have caught students attempting to cheat in one form or another Both professors and students are responsible for upholding the reputation of the university Cheating is often purposeful in nature but an unawareness of course or university policies and assignment requirements could also create confusion about what is and is not allowed Regardless of intention cheating can never be justified especially once you have learned the ways that it can negatively impact your college career and life outside the university Stay on the right path Know course policies on assignments collaboration exams Check the Syllabus If ethical dilemmas arise seek advice from trusted faculty or staff on campus on how you should deal with it Protect yourself It is your responsibility to clarify when collaboration is allowed and when it is not Different cultures and educational systems can vary in how information is used and credited Reach out to your instructors early to avoid misunderstandings

1 point Match the factors for cheating with an appropriate example Excuse making Performance anxiety Unfamiliarity with what constitutes cheating Peer pressure Self justification habits Inability to manage demands of student life O Return Falco Submit Cheating because social and academic lives have become too disorganized or stressful to manage 1 point Genuinely misunderstanding a Cheating is justified if the professor has unfair or difficult q course policy requiring individual work True Cheating to compensate for poor Blaming the reason for cheating on the course instructor being too hard 11 might attempt to gain academic credit in a way that is unfair deceitful or fraudulent Every semester at CSUB the Dean of Students receives reports from professors who have caught students attempting to cheat in one form or another Both professors and students are responsible for upholding the reputation of the university Cheating is often purposeful in nature but an unawareness of course or university policies and assignment requirements could also create confusion about what is and is not allowed Regardless of intention cheating can never be justified especially once you have learned the ways that it can negatively impact your college career and life outside the university Stay on the right path Know course policies on assignments collaboration exams Check the Syllabus If ethical dilemmas arise seek advice from trusted faculty or staff on campus on how you should deal with it Protect yourself It is your responsibility to clarify when collaboration is allowed and when it is not Different cultures and educational systems can vary in how information is used and credited Reach out to your instructors early to avoid misunderstandings