Ecology - General Questions and Answers
Biology
Ecology - Generalnt of the following are definitions of cheating Obtaining answers from someone or giving someone answers through dishonest or deceptive means Studying with a group prior to an exam attempting to gain academic credit in an unfair deceitful or fraudulent way Unauthorized use of information materials and sources when completing academic activities int h the factors for cheating with an appropriate exampl Cheating because social and academic lives have become too disorganized or stressful to manage use making formance anxiety Blaming the reason for cheating on the course instructor being too hard DO professors who have caught students attempting to cheat in one form or ano Both professors and students are responsible for upholding the reputation of university Cheating is often purposeful in nature but an unawareness of COL university policies and assignment requirements could also create confusion what is and is not allowed Regardless of intention cheating can never be jus especially once you have learned the ways that it can negatively impact your college career and life outside the university Stay on the right path Know course policies on assignments collaboration exams Check the Syllabus If ethical dilemmas arise seek advice from trusted faculty or staff on campus on how you should deal with it Protect It is your responsibility to when collaboration is allow when it is not Different cultures and education can vary in how information is u credited Reach out to your inst early to avoid misunderstanding
Biology
Ecology - GeneralPart III Which medium would you consider to be minimal or defined 12 KAMPO EROPON EP Hao O Medium 1 Modium
Biology
Ecology - Generalmaterial organic I a Examine the two samples of shale and the peat Which ones formed in anoxic environments
Biology
Ecology - GeneralIn some reptiles incubation temperature of the nest determines the sex ratio Select which answers best fit what the figure below is indicating Percent males 100 80 60 40 20 O Low Incubation temperature High KEY Many lizards alligators Many turtles Leopard geckos snapping turtles crocodiles Temperature dependent sex determination is a genetic factor found in some reptiles Embryos of snapping turtles become male at lower temperatures There is a equal chance of both male and female leopard geckos developing at intermediate incubation temperatures Alligators eggs incubated at higher temperatures all become males Particularly in reptiles there is a large degree of variability in sex determination
Biology
Ecology - GeneralClaim Does the claim address the question Is the claim a complete sentence so that it can stand alone without needing the question Is the claim relevant to the question Is the claim accurate Not At Partially All Yes
Biology
Ecology - GeneralThe fossil record although incomplete provides evidence about the history of life and illustrates that most species have remained unchanged over time O True False 1 p
Biology
Ecology - GeneralGenetic drift is O generational fluctuations in gene frequencies that produce no effect O the effect of mutations as they spread through neighbouring populations O changes due to interbreeding with other species populations random changes in gene frequency in a population
Biology
Ecology - GeneralGenetic drift is most powerful in O small populations Olarge populations O changing environments
Biology
Ecology - GeneralAnnelids are most commonly known worms Are Annelids more closely related to Mollusca or to Arthropoda
Biology
Ecology - Generalermata Echinoderms include sand dollars and sea urchins and sea stars Are Echinoderms more closely related to Chordates or Arthropods
Biology
Ecology - GeneralChordata Chordates have a central nerve cord running down their backs Many also have a backbone surrounding this cord of nerves Name three chordates with which you are familiar other thar the examples
Biology
Ecology - General2 Mycobacterium tuberculosis This slide shows M tuberculosis tiny black dots inside a human lung cell i e from the Eukarya branch The lung cell has ruptured all the pinkish material is part of the ruptured cells The large black dots are nuclei of the lung cells not the Mycobacterium How does the size of the
Biology
Ecology - GeneralThere are 2 common options for in text citations in APA Select the correct 2 options below Author s last name in the body of the sentence followed by the page number in parentheses Author s last name in the body of the sentence followed by the date in parentheses Author s last name and date shown in parentheses at the end of the sentence O Author s last name and page number of information shown in parentheses at the end of the sentence
Biology
Ecology - GeneralYa bister i kemhada ya viranede can ver un bay u geda hake beraber girecektir Allah a si in ahs h limin gazab ndan Zira yumu ak huylu at n iftesi pektir Tanzimat airlerinden Ziya Pa a ya ait bu dizelerle gili olarak a a dakilerden hangisi s ylenemez A Bi im olarak eski edebiyat n bir devami niteli inde du u B Son beyitte irsali mesel sanat n n kullan ld C Arap a Fars a s zc klere yer verildi i D Ahenk unsurlar ndan yararlan lmad E Aruz l s ve beyit birimiyle olu turuldu u
Biology
Ecology - GeneralDraw a three pronged tree that depicts the three major groups of organisms on earth the Domains and their correct relationships to one another Name each branch and provide a brief description of their general attributes Save the file in Word or PDF format and upload here
Biology
Ecology - GeneralCASE STUDY You work in a busy nursing center Today you are responsible for caring for 12 residents You have been able to keep up with all of your duties however the nurse is running behind on her day s task She has requested you to deliver Miss Jones s medications to her Miss Jones is alert and oriented She knows what medications she takes and is able to swallow them without difficulties 2 How do you respond to the nurse delegating this task to you 3 Do you need to report the nurse s request to anyone Explain 1 Is this a task within your role Explain les delivering Miss Jone s presicatia s is within my role Foll handle administration important to ensure
Biology
Ecology - GeneralAnswer the following prompt in a three sentence paragraph Which faction was the best when it came to both exploration and expansion 15
Biology
Ecology - GeneralExplain how these structures model an alveolus Red and blue paper Balloon O Straw
Biology
Ecology - GeneralMistakes during DNA replication can cause mutations in the DNA can lead to which of the following A abnormal development B Cancer C There is no effect D A and B
Biology
Ecology - GeneralTopic 1 Practice 1 Choose the best answer The scientific method seeks to ensure that a understanding is based on evidence b only deductive and not inductive reasoning is used c researchers are not methodologically materialistic d hypothesis testing science is favoured over descriptive science e hypotheses are proven
Biology
Ecology - General11 The pictures below represent endocytosis and exocytosis Describe what is happening in each picture Endocytosis Exocytosis
Biology
Ecology - GeneralHomo erectus is one of the first hominins in which we have evidence for living into older age What might this also imply about their life history or social behaviors Check your answer in Section 5 Longer life span may also make longer childhoods and thus more social learning possible O Homo erectus learned western medicine via observation of Neanderthals O Homo erectus had a clear gendered division of labor Homo erectus was likely to die in childbirth
Biology
Ecology - GeneralDuring the end of the Pliocene we see lots of possible taxonomic diversity different hominin species competing against each other in Africa What might have given our lineage an advantage over other more specialized lineages like Paranthropus or Australopithecus hold outs like A sediba check your answer in section 5 Maintaining arboreal traits O Development and consistent use of stone tools Chewing adaptations for heavy grinding Fire and art
Biology
Ecology - Generalfying some genes that are important in the onset of lung cancer You have several genes you think may be involved so you print spots of the candidate DNA sequences on a microarray slide After doing this you isolate mRNA from both normal lung cells and cancerous lung cells You make fluorescently tagged cDNA from each mRNA sample the cDNAs from normal cellsare tagged with a green colored molecule and the cDNAs from cancer cells are tagged with a red colored molecule You hybridize the cDNAs with the microarray and get the following data Green spots are labeled with G red spots are labeled with R 1 2 3 4 5 6 7 A B C R McGraw Hill Education Which of the following spots represent DNA that you should study further as potentially having a role in lung cancer spots A1 and C6 spots B4 and B6 all spots except A1 and C6 8 all spots except A1 B4 B6 and C6 spots A1 B4 B6 and 6
Biology
Ecology - Generalmouse skeletal stem cells mSSC It shows the stem cell family tree that can be generated from mSSCs The figure shows each cell type with its marker profile means the protein is expressed means the protein is not expressed Apply your knowledge of how FACS analysis works to indicate how the mSSC marker profile could be used to isolate the mSSCs from tissues There are eight 8 markers named CD45 TER119 Tie2 AlphaV Thy 6C3 CD105 CD200 You should address all of the markers mentioned for the mSSC in your answer Mouse Cartilage Cartilage progenitors CD45 TER 119 Tie2 AlphaV Thy 6C3 Bone Osteoprogenitors CD45 TER 119 Tie2 AlphaV mSSC CD45 TER 119 Tie2 AlphaV Thy 6C3 CD105 CD200 BCSP CD45 TER 119 Tie2 AlphaV Thy 6C3 CD105 B lymphocyte stromal progenitor Stroma 6C3 cells Hepatic leukemia CD45 TER factor expressing 119 Tie2 cells
Biology
Ecology - GeneralA primary research article is one which contains the methods results and discussion of laboratory research True False
Biology
Ecology - GeneralBrain size is important for understanding intelligence but there are several caveats that indicate that brain organization and learning experiences are more important than brain size alone For example check your answer in section 2 and 5 The Flores hominins had very small brains but still exhibited behaviors similar to larger brained Homo erectus used stone tools hunted and built fires Neanderthals had larger brains that most humans but did not appear to be consistently producing art like smaller brained modern human were all of these brain sizes within the same species do not appear to have any relevance to intelligence in those species brain size scales with body size
Biology
Ecology - GeneralHeavy brow ridges in Homo heidelbergensis do not appear to have any obvious adaptive purpose It seems likely that these exceptionally large brow ridges may instead be largely the product of check your answer in section 1 and section 5 O expensive tissue hypothesis O Mendel s principle of independent assortment means that traits such as intelligence cranial shape hair or skin color do not necessarily co occur and indeed do not O genetic drift natural selection
Biology
Ecology - GeneralWhich of the followings does NOT describe Job Guarantee program it directly addresses the issue of Al artificial intelligence and robots taking over jobs it is federally funded and locally administered as the federal government can finance the program and local governments know their local needs to be addressed through the program it is counter cyclical thereby helping stabilize an economy it ensures full employment since anyone willing and able to work can find a job in the program
Biology
Ecology - GeneralA decrease in the price of crude oil would most likely decrease aggregate demand in the United States decrease aggregate supply in the United States increase aggregate supply in the United States increase aggregate demand in the United States
Biology
Ecology - GeneralIf your nominal income has gone up 5 and inflation has simultaneously increased by 6 what would happen to your real income decreased by 1 decreased by 11 increased by 1 increased by 11
Biology
Ecology - GeneralOpportunity cost is the combined value of all the alternatives not selected based on the intrinsic value of the good itself the value of the next best alternative which was given up the same thing as the money price of a good
Biology
Ecology - General5 TRPV4 is a gene in cats that encodes for calcium permeable ion channels The Scottish Fold is a breed of cats that has a mutated dominant TRPV4 gene Mutations to this dominant gene cause developmental issue in bones and cartilages One copy of the mutated dominant gene causes the the signature fold in the ears of the Scottish Fold breed Two copies of the dominant gene cause a condition known as osteochondrodysplasia crippling effect and causes significant issues to the tail limbs and paws of the cat Imagine you are a part of the local government and have been tasked with creating a set of rules for breeders of Scottish Fold cats 1 Determine all possible gene combinations and their resulting phenotypes 2 Determine the acceptable genotypes that breeders can cross so that no cats will be born with osteochondrodysplasia
Biology
Ecology - GeneralCan you write a takehome message about what you learned about career service
Biology
Ecology - GeneralWhich choice best describes data from the table that support the team s conclusion Choose 1 answer B Adenine and xanthine were detected in both of the meteorite samples and in the soil sample Isoguanine and hypoxanthine were detected in the Murchison meteorite sample 1 but not in sample 2 Isoguanine and purine were detected in both meteorite samples but not in the soil sample Hypoxanthine and purine were detected in both the Murchison meteorite sample 2 and in the soil sample
Biology
Ecology - GeneralWhich antibiotic would the doctor NOT prescribe to a patient with an infection caused by the bacteria growing on this plate View Image Ciprofloxacin Rifampicin
Biology
Ecology - GeneralWhich process eliminates all vegetative cells endospores spores and viruses from culture liquid media in glass bottles O Disinfection O Antisepsis O Sterilization Sanitization Sanitization O Disinfection O Sterilization O Antisepsis
Biology
Ecology - GeneralTrue False Question 6 2 points E Listen The Supreme Court ruled in Kane v Garcia Espitia that detainees who are representing themselves in a criminal trial must have access to all legal materials available to convicted prisoners in state prisons True False Question 7 2 points Saved 4 Listen Saved A pardon granted under federal law totally discharges a person from all effects of the conviction resulting in the restoration of voting rights and other civil rights True False Question 8 2 points Listen All of the following are accurate statements about federal supervised release except A term of supervised release is imposed are the time of sentencing All supervised release violators are subject to mandatory periods of additional confinement if conditions of supervised release are violated Persons on supervised release have conditions that are monitored by probation officers
Biology
Ecology - GeneralA cell biologist produces a karyotype of mouse somatic cells arrested in mitosis She sees 40 chromosomes which is completely normal for mice Based on this information what is the haploid number of chromosomes for mice OO 10 20 40 80 O It cannot be determined from the information provided QUESTION 44 is a process of nuclear division which reduces the number of chromosomes per cell from 2 sets to 1 set O Mitosis O Meiosis O Binary fission O Syngamy
Biology
Ecology - GeneralWhich of the following is an example of the founder effect A tornado destroys all but 15 individuals in a toad population A group of 15 male and female birds from one species are stranded on an island Only ampicillin resistant bacteria survive in an ampicillin rich medium A group composed of 12 male birds from one species is released 5 miles from their home range
Biology
Ecology - General12 Prepare 200 mL of 20 Sodium Dodecyl Sulfate SDS 13 Prepare 500 mL of 70 Ethanol 14 Prepare 500 mL of Plant DNA extraction Buffer 200mM Tris buffer 250 mM NaCl 25 mM EDTA and 0 5 SDS from stock solution that you make 1M Tris 0 5 M EDTA 5M NaCl and 20 SDS
Biology
Ecology - GeneralQUESTION 5 Place the steps of mitosis in chronological order Metaphase Prophase Telophase Anaphase QUESTION 6 Match the stage of mitosis with the correct description Metaphase Prophase Anaphase Telophase A Condensed chromosomes Nuclear envelop disappears B Chromosomes are pulled to opposite sides of the cell C Nuclear envelop appears around new nucleus D Chromosomes line up at the midpoint of the cell
Biology
Ecology - GeneralThere are no differences between the telophase cytokinesis in animal and plant cells True O False QUESTION 8 The plant pigment that provides yellow orange colors in plants is O Chlorophyll A O Carotene O Chlorophyll B O Melanin QUESTION 9 Most of the carbon that is incorporated into plants to give them mass and grow larger comes from O Carbon in the soil O Water O The sun
Biology
Ecology - GeneralThe energy that supplies all living systems on earth ultimately comes from what QUESTION 11 The alcohol during the DNA extraction is used to separate the DNA from all of the other components of the cell O True False QUESTION 12 In a molecule of chlorophyll O Gold O Lithium Iron is the element in the middle of the molecule
Biology
Ecology - General2 In Drosophila an X linked mutation Bar eye B causes slit like eyes Wild type females X X and males X Y have round eyes Males with the B allele XBY and females homozygous for the B allele XBXB have slit like eyes Heterozygous females X XB have kidney bean shaped eyes What phenotypes in what ratios will occur in the F and F generation if a a bar eyed female is crossed with a round eyed male 3 points b a bar eyed male is crossed with a round eyed female 3 points
Biology
Ecology - GeneralQuestion 9 SARS D The same region in the genome of virus isolated from a young otherwise healthy patient who exhibited particularly severe symptoms read 5 AAUUACCGUAUAGAUUGUUU 3 What is the mutant protein sequence select all possible answers H3N NYRIDCL coo H3N FLRYLYN coo H3N NYLYRLF coo O H N NY YRLF coo H3N NYRIDCF coo H3N NYRYRLF coo
Biology
Ecology - GeneralSketch models of the wildtype lac operon and the adjacent lacl gene and the mutant your friend created Indicate on your sketches the positions of the promoter the operator the structural genes lacz lacy lacA and the lacl gene Take a picture of the sketch and upload the file
Biology
Ecology - GeneralI P O ZY A deletion in the middle of Z glucose and lactose lactose glucose Question 29 I dp O Z Y A repressor can t bind to 0 glucose and lactose lactose glucose Question 30 Choose Choose Choose Choose Choose Choose To determine whether the mutations in each of the mutanto pr
Biology
Ecology - GeneralStormy husky brawling City of the Big Shoulders They tell me you are wicked and I believe them for I have seen your painted women under the gas lamps luring the farm boys And they tell me you are crooked and I answer Yes it is true I have seen the gunman kill and go free to kill again And they tell me you are brutal and my reply is On the faces of women and children I have seen the marks of wanton hunger And having answered so I turn once more to those who sneer at this my city and I give them back the sneer and say to them Come and show me another city with lifted head singing so proud to be alive and coarse and strong and cunning Flinging magnetic curses amid the toil of piling job on job here is a tall bold slugger set vivid against the little soft cities Fierce as a dog with tongue lapping for action cunning as a savage pitted against the wilderness Bareheaded Shoveling Wrecking Planning Building breaking rebuilding Under the smoke dust all over his mouth laughing with white teeth Under the terrible burden of destiny laughing as a young man laughs Laughing even as an ignorant fighter laughs who has never lost a battle Bragging and laughing that under his wrist is the pulse and under his ribs the heart of the people Laughing Laughing the stormy husky brawling laughter of Youth half naked sweating proud to be Hog Butcher Tool