Principles of Inheritance & Variation (Genetics) Questions and Answers

Deoxyribonucleic acid is a molecule that carries genetic information in cells True False Cytokinesis is the portion of the cell cycle between mitotic divisions when the genetic material is duplicated True False 1 point 1 point

Which non disjunction disorder does the individual with this karyotype have XXXK 3 2 5 Y 8 9 10 12 115 14 13 15 16 17 11 41 1 19 20 21 22 X Patau syndrome 6 b Down syndrome c Turner syndrome Od Edwards syndrome Ir 18 1 poin

10 Eye color red or white in the fly Drosophila is determined by the X chromosome The dominant version of the allele XR causes red eyes while the recessive allele causes white eyes X Females can have red eyes XRXR XRX or white eyes X X Males only receive one copy of the X chromosome so whatever allele version they receive determines their eye color If a white eyed male is crossed with a red eyed heterozygous female what will the phenotypic ratios of the offspring be

RNA PROCESSING involves which of the following A addition of a nucleotide 5 cap to the molecule B addition of a poly A tail to the molecule C RNA splicing D A and B only E A B and C

Muscle cells and nerve cells in one species of animal owe their differences in structure to having different chromosomes using different genetic codes having different genes expressed having unique ribosomes

Which of the following statements is true about base paring in DNA Guanine G binds to Adenine A whereas Thymine binds to Cytosine C Adenine binds to Thymine T wheras Guanine binds to Cytosine C

Females need of a recessive sex linked gene to express the recessive phenotype one copy two copies throo conic

Duchene s syndrome color blindness and hemophilia are examples of disorders caused by a recessive sex linked gene dominant autosomal disorder diet exposure to radiaation

6 Explain the general process of transcription including the three major steps of initiation elongation and termination 7 Explain how RNA is modified after transcription in eukaryotic cells f RNA

4 Define codon and explain the relationship between the linear sequence of codons on mRNA and the linear sequence of amino acids in a polypeptide 5 Explain how RNA polymerase recognizes where transcription should begin Describe the promoter the terminator and the transcription unit

Which term refers to a specific form of a gene cross O allele O hybrid trait

The parent plants used in a cross are referred to as the F1 generation True False

Autosomal inheritance refers to the inheritance of alleles located on sex chromosomes O True O False

A monohybrid cross is a cross designed to study the inheritance of only one 1 point trait O True O False

A Punnett square is a tool used for determining the probability of a single offspring having a particular genotype True False

Which statement s is are true about heredity Each parent passes on to its offspring two alleles for each gene Recessive alleles when present are always expressed in the phenotype Dominant alleles are only expressed when they are the only allele present in a genotype none of the above 1 pc

A garden pea with a purple flower is crossed with a garden pea with a white 1 poi flower and produces offspring all of which have purple flowers The offspring then self pollinate Based on the results of Mendel s experiment out of 1000 garden pea plants in the F2 generation approximately how many plants would have white flowers 250 plants 750 plants 0 plants 1000 plants

Cystic fibrosis is a recessive autosomal trait What is the probability of two heterozygous parents Ff conceiving a child with Cystic fibrosis ff 18 75 56 25 O 75 25

Which term describes an individual that carries two of the same alleles for a given characteristic phenotype heterozygous homozygous genotype

4 In rabbits the homozygous CC is normal Cc results in deformed legs and cc results in very short legs The genotype BB produces black fur Bb brown fur and bb white fur If a cross is made between brown rabbits with deformed legs and white rabbits with deformed legs what proportion of the offspring would be expected to have deformed legs and white fur A 1 4 B 1 3 C none D all E 1 2 all of their

DNA Rep Directions Drag the cards below to fill in the blanks in the paragraph about DNA replication lagging strand helicase There are many strand while I The 1 an RNA primer that lets i DNA primase 11 n 1 Topoisomerase Okazaki DNA fragments polymerase involved in DNA replication enzymes breaks the hydrogen bonds between bases I is made continuously while the I These fragments are glued together by I unwinds the DNA know where to begin adding new nucleotides ligase leading strand lays down is made in fragments called

has an intact WT normal repressor gene 1 and intact lac operon is labeled as I P O Z Y A where superscripted denotes a normal gene or control element A mutation in the specific gene or control element will be denotec by a different superscript In the next series of questions you will be presented with several E coli strains mutants or WT that were grown in medium containing either glucose lactose or both For each of these strains match the growth conditions with the expected levels of the enzyme galactosidase B Gal The expression levels to choose from are high low and no activity The first strain is the WT strain I P O Z Y A lactose glucose and lactose glucose Question 25 I P OcZ Y A point mutations in O glucose and lactose glucose high low no activity Choose Choose 3 pts

Assume in the questions below that the affected individual has an autosomal recessive disorder Use TO 2 I 1 2 I What is the genotype of I I 2 How do you know H II 2 1 2 7 What is the genotype of II 8 How do you know I II I 2 3 What is the genotype of II 4 How do you know Assume in the questions below that the affected individual has an autosomal dominant disorder Use B and b I 2 II 10 How do you know 2 2 9 What is the genotype of II 1 I II I 2 5 What is the genotype of I 2 6 How do you know 2 I II 2 1 2 II What is the genotype of I 1 12 How do you know

A Construct explan Explain what is meant by turning on and turning off genes within a cell during cell differentiation 1 DREVEA 2 Describe the process of one type of cell signaling in embryonic development nospraul 3 An individual who inherits two of the same allele either BOTH a 900 2916m31 bns aslem nsswiad babivib vinavanu 915 15 s for a particular characteristic has a c Atrob b demonstrates lerne genotype gions to histASAS recessive homozygous dominant B Answer the following questions Jons What is the relationship between phenotype and genotype mucous alleles og m SEP TORE ming or BOTH

7 How does knowledge of the Bombay phenotype completely destroy the paternity case described in 6 2 points

5 Tongue rolling is a dominant trait R Non tongue rolling is recessive r Patrice and Janeane are both heterozygous tongue rollers What is the probability they will have a non tongue tolling child 2 points

Match the term with the most appropriate correct description In grasshoppers the male will have chromosomes A CVS In birds females will have chromosomes B Hemophilia The process by which fetal cells are collected by insertion of C Amniocentesis a sterile needle into the amniotic cavity D Aneuploidy E Nondisjunction F Maternal inheritance G SNP H Monosomic I Dosage compensation J ZW K Genomic imprinting L Genetic mosaics M XO N Trisomic RETETEE EREREDER The process of collecting fetal cells through the chorionic villus through the cervix The x linked condition in which blood clot formation does not occur Equal levels of expression occur from the sex chromosomes despite having differing number of sex chromosomes in males and females Females that are heterozygous for X chromosome alleles Uni parental inheritance specifically from the mother Polymorphisms that affect a single base of a gene s locus When nondisjunction causes the gain or loss of a chromosome Individuals who have gained an extra autosomal chromosome Individuals who are missing one of their autosomal chromosomes The failure of homologous chromosomes to separate during meiosis When a mutant allle is expressed when the allele comes from one parent but not the other

If the genetic code were comprised from staggered overlapping codons how many complete codons would the following sequence encode before encountering a stop codon 5 AUGCGAUUAUAAGUGC 3 O 4 10 15 06

What may be the ramifications of your analyses of the RNA you isolated It is clearly containing an ORF which is longer than what you expected to find based on the sequence analysis you have conducted What would be a logical conclusions based on the comparison of the lengths of the actual and predicted ORFs Questions How many times do we need to tell you to stop 1 through 6 Nature is random and your results using the Bard s words may be full of sound and fury but are really signifying nothing The difference between the actual and predicted sizes of the ORF is rather big and may suggest that the sequence of the RNA may not be as random as it first appeared This raises the hypothesis that what started as piece of junk RNA may be actually encoding for a protein The difference between the actual and predicted sizes of the ORF is not big enough to be significant and therefore your initial hypothesis that sequence is random is clearly random is supported

3 If a man expresses an X linked recessive trait all of his brothers will also express it a b C d e For the trait his father transmitted the trait to him his father carried the trait all of his sisters will also express it his mother was heterozygous or homozygou

5 Y linked traits are males a b C d expressed known as homozygous traits known to skip generations in males carried only by males and transmitted only to carried only by females but are never

e an allele passed from parent to child on a sex chromosome O a geneticist who studies the inheritance of traits in humans A chart that tracks which members of a family have a particular trait OO a picture of all of the chromosomes in a cell

Can you please send me a primary research article about protein synthesis involved in creating the traits of a human being

subunits transcription process catalyzes the association between the large and small ribosomal an enzyme that uses RNA as a substrate an RNA with enzymatic activity Question 40 1 point Listen Saved The 5 end of a DNA molecule can be chemically distinguished from the 3 end because there is a n group at the 5 end and a n group at the 3 end hydroxyl hydrogen amine carboxyl

conservative dispersive irregular Question 28 1 point Saved 1 Listen Which of the following is involved in proofreading during DNA replicat ORNA polymerase endonuclease activity of DNA polymerase exonuclease activity of DNA polymerase

What is the function of topoisomerase adding methyl groups to bases of DNA relieving strain in coils in the DNA ahead of the replication fork unwinding of the double helix elongating new DNA at a replication fork by adding nucleotides to the existing chain

Complete the table that compares DNA and RNA Telomeres present Carbon 2 has a Involved in translation Table differentiates DNA and RNA Select Select Select DNA Answer 1 Answer 3 Answer 5 Select Select V Select RNA Answer 2 Answer 4 Answer 6

The image shows a human karyogram X XXK 1ampal From which person was the karyogram obtained A A female with Down syndrome K XA male D A male without Down syndrome B A female without Down syndrome A male with Down syndrome V

Question 6 Which of the following sentences are correct about regulation of gene expression in Eukaryotes O gene expression might vary across different cell types tissues 20 pts O gene regulation in eukaryotes is more complex than in prokaryotes regulation in eukaryotes depends on activation inactivation of the Operon region O gene regulation in eukaryotes have cis and trans regulatory elements controlling gene expression gene regulation in eukaryotes only occurs

What is the phenotype ratio of the following cross BbYy X BbYy 4 1 9 3 3 1 2 2

Silent GUA Val GUG Nonsense protein is shorter GCC GCA GCG O Nonsense protein is longer Ala GAC Asp GAA Glu GAG AUG Met or Start UAG UAA and UGA Stop GGC GGA GGG The gene KRTHAP1 codes for the production of hair keratin in humans and other primates It is this gene that is thought to be responsible for humans having relatively little body hair compared other primates Gly A portion of the template strand of the chimp gene 3 ACGACCGCT 5 A portion of the template strand of the human gene 3 ACGACTGCT 5 What type of mutation occurred in humans to result in our relative hairlessness C Dept Biol Penn State 2002

Which of the following DNA strands is the template strand for this molecule of mRNA

Given this DNA template strand What is the mRNA strand that is produced 5 AUUUGCGAUAGGCA 3 3 ATTTGCGATAGGCA 5 5 UAAACGCUAUCCGU 3 5 ATTTGCGATAGGCA 3 3 UAAACGCUAUCCGU 5

Question 7 The genetic code is said to be redundant because one anticodon can attach to several amino acids there is more than one start codon one amino acid can have more than one codon

Question 3 Which of the following mutations would likely be most dangerous to a cell Deletion of three nucleotides Deletion of one nucleotide Substitution of one nucleotide for another

First Base 5 is too short UA CUG G AUU ACU A AUC lle ACC AUA ACA AUG ACG CCA CCG GUU GUC GUA Val GUG GCU GCC GCA GCG Thr Ala AUG Met or Start UAG UAA and UGA Stop CAA CAG Gin has the amino acid Trp in place of the amino acid Cys AAU AAC Asn AAA AAG Lys GAU GAC GAA GAG Asp Glu CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly DAG UCAG UCAG Dept Biol Penn State 2002 You are studying a protein and have sequenced the DNA that encodes it There is also a mutant version of the protein that does not function correctly When you transcribe the DNA to obtain the mRNA sequence you find that at one position there has been a mutation from 5 UGC 3 to 5 UGA 3 Using the genetic code you determine that this mutant protein ird Base 3 end

The coding strand of a DNA molecule that encodes an mRNA molecule has the same nucleotide sequence as the template DNA strand has the complementary nucleotide sequence to the mRNA molecule with Ts instead of Us has the same nucleotide sequence as the template DNA strand except for the 3 5 polarity has the same nucelotide sequence as the mRNA molecule with Ts instead of Us

1 2 3 DNA mRNA GAA Protein Glu DNA TTA AAT mRNA UUA Protein Leu COC GGG mRNA CCC Protein Pro DNA 111 Stop GT CCA Pro AC 5 What other types of mutations do you know

Finding the consensus B The coding strands sequences below represent promoter regions of several genes of the bacterium Generalus geneticus Based on the following sequences what will be the most common first base of the nascent transcript 40 35 30 25 20 15 10 5 1 GCGCTTTAATAGCATAGCTGTCTCCGT TTTGATCAGGTT AAA CTTCATTGGTAACCCCACTGCATCGACC TAATACTATCAA AGC GACCGTAGATCACACGACCAGTTCGGGGGTATGAAGAGAATTGAA TAGACCTGATTTATGAATCCCAGAGAAC GAGAATGGACAA ACC AGGCCTTGATTGGCGGAACCGGGACT TATGATGCGGGGCACA GAAGGTTGAGAAGATTCGGAGGGCTCAT TATGAACACAGGCCCG CCACCTTGATAACGACACGTACGGGCCG CATGATTGGCGC ACC AGCCATTGATATGAGATCAGACAGCCGCGTAATGTTCACCGGAGA ACCAAATGATAAAAAAGTCAACCAGAC TATGATAACGAATATC ACCCATCGATAACAGGTAAAACGCCCCC TATGATATAGGGCACT OU Take Quiz A

that would result It THCS Mad chudren A Last the possible genotypes and phenotypes for their children B What are the chances of a child with light blue skin C What are the chances of a child with light green skin 96 Mr Krabbs and his wife recently had a Lil Krabby but it has not been a happy occasion for them Mrs Krabbs has been upset since she first saw her new baby who had short eyeballs She claims that the hospital goofed and mixed up her baby with someone else s baby Mr Krabbs is homozygous for his tall eyeballs while his wife is heterozygous for her tall eyeballs Some members of her family have short eyes which is the recessive trait Create a Punnett square using T for the dominant gene and t for the recessive one A List the possible genotypes and phenotypes for their children B Did the hospital make a mistake Explain your answer