Principles of Inheritance & Variation (Genetics) Questions and Answers

GUU G GUC GUA GUG Val too short GCU GCC GCA GCG AUG Met or Start UAG UAA and UGA Stop Ala too long as the amino acid Trp in place of the amino acid Cys GAU GAC GAA GAG Asp Glu GGU GGC GGA GGG Gly ou are studying a protein and have sequenced the DNA that encodes it There is also a utant version of the protein that does not function correctly When you transcribe the DNA obtain the mRNA sequence you find that at one position there has been a mutation from UGC 3 to 5 UGA 3 Using the genetic code table you determine that this mutant protein SCAO G

The following is a strand of mRNA 5 AUUCGGCAUUCC 3 Which of the following DNA strands is its template 1 5 TAAGCCGTAAGG 3 2 5 GGAAUGCCGAAU 3 3 5 GGAATGCCGAAT 3 4 5 AUUCGGCAUUCC 3 1 2

The following is an mRNA sequence Which of the following sets of anticodons would be present during translation 1 5 TTAGGTAAA 3 2 5 UUAGGUAAA 3 3 5 AAATGGATT 3 4 5 AAAUGGAUU 3 01 2 5 AAUCCAUUU 3 3

Which statements describe independent assortment Check all that apply Independent assortment occurs during meiosis II Independent assortment happens during fertilization Independent assortment results in different combinations of genes in sex cells O Independent assortment makes offspring identical to their parents Independent assortment occurs when chromosomes randomly line up in the middle of the c

To determine if a plant with purple flowers is homozygous PP or heterozygous Pp for that trait one would do a test cross with plants of the genotype pp

For this pre lab assignment you will submit a 1 page drawing that demonstrates the differences between Mendel s two main laws the law of segregation and the law of independent assortment in a 2N 4 cell on your drawing include a hypothetical gene A on one pair of chromosomes a dominant A allele on one chromosome and the recessive a allele on its homologous partner and a hypothetical gene B on the second pair of chromosomes a dominant B allele on one chromosome and the recessive b allele on its homologous partner Include a written description of the main differences between the two laws and explain how each law impacts the movement of the gene A and gene B alleles into gametes You can using a drawing program or you can hand draw

Enzyme that unwinds DNA Fragments of copied DNA created on the lagging strand The strand that is copied in a continuous way from the 3 to 5 direction Binds Okazaki fragments Builds a new DNA strand by adding complementary bases Stabilizes the DNA molecule during replication Strand that is copied discontinuously because it is traveling away from helicase Initiates the synthesis DNA by creating a short RNA

Individuals who have become addicted to opioids have used liquid water to dissolve powdered pills for quicker delivery through injection Identify the diagrams depicting the solid liquid and gas phases of water on the image liquid gas solid Drag each item above to its appropriate location in the image Note that every item may not have a match while some items may have more than one match H H

A diploid set of homologous chromosomes where 2n 6 in Meiosis A Draw Prophase of Meiosis I prior to crossing over label homologous chromosomes a chromosomal tetrad and note where the alleles are that you marked Q How many chromosomal tetrads does this D Draw Anaphase I and Telophase I Q a What happens to the alleles of the gene loci you marked at this stage b Which of Mendel s Laws does this explain c What are the genotypes of the resulting daughter cells d How many different results can you possibly get e Which of Mendel s Laws does this explain

Use the following mRNA codon key as needed to GCC Alanine AAU Asparagine CCU Proline GGA Glycine UGG Tryptophan UGA Stop no amino acid GAA Glutamic acid GAG Glutamic acid AGG Arginine CCC Proline CAU Histidine The following DNA sequence coding strand occurs near the middle of the coding region of a gene DNA 50 mRNA 55 50 5 AATGAATGGGAGCCTGAAGGAG 3 The corresponding mRNA sequence is shown below Note that the coding strand of DNA has the same sequence as the mRNA except that there are U s in the mRNA where there are T s in the DNA The first triplet of nucleotides AAU underlined is in frame for coding and encodes Asparagine as the codon table above indicates OA G at position 50 60 55 OC A at position 58 65 OG A at position 53 swer this 60 5 AAUGAAUGGGAGCCUGAAGGAG 3 65 Which of the following DNA mutations is almost certain to result in a shorter than normal protein

Two different genes are located on the same chromosome in rabbits A particular female rabbit is heterozygous for alleles of both genes with alleles arranged as shown in the diagram to the right Scientists know that the two genes are on the same chromosome but do not know their exact relative positions as indicated by the dashed line Suppose this female mates with a male rabbit in which the same chromosome pair looks like this r Tr e tie Which of the following statements best describes the likelihood that this pair of rabbits would have offspring with a chromosome pair that looks like this R T E i e RTH 11 e tie O More likely if the two genes are very close together on the chromosome O More likely if the two genes are not very close together on the chromosome O Not likely because the R and e alleles are not on the same chromosome in either parent O Very likely because the random assortment of chromosomes during cell division to make sperm or eggs allows for the mixing of all alleles

4 In corn yellow kernel color is dominant over white kernel color A random sample of 1 000 kernels from a population that is at equilibrium showed that 875 are yellow and 125 are white What are the frequencies of the yellow and white alleles in this population What is the percentage of heterozygotes in this population

1 1 Maltose is a carbohydrate molecule that provides energy to plants early 1 poin in their life cycle Which elements are most common in a molecule of maltose magnesium and sulfur iron and phosphorus copper and nitrogen carbon and hydrogen d

In an isolated population of 50 desert bighorn sheep homozygosity for a recessive allele c causes curled coats The wild type dominant allele C produces straight coats A biologist studying these sheep counts 4 with curled coats She also takes blood samples from all of the sheep in the population for DNA analysis which reveals that 17 of the sheep are heterozygous carriers of the callele What is the coefficient of inbreeding F for this population Begin by calculating values for p frequency of C and q frequency of c without assuming random mating O 0 08 O 0 91 O 0 09 O 0 25

people You are an epidemiologist visiting an isolated village in the sub Saharan African nation of Somalia There are 30 in this village and you diagnose 25 with sickle cell anemia which is a recessive autosomal disorder Assume that mating is random in this population and round to 3 decimals in your calculations Part 1 What is the frequency of the recessive phenotype What is the frequency of the recessive allele Part 2 Given the frequency of the recessive allele what is the frequency of the dominant allele O 0 083 O 0 957 O 0 917 O 0 711 Part 3 Given the information you have determined so far in order to calculate the predicted frequency of heterozygotes in the population you should now take the frequency of the two alleles p Vand q to calculate the final answer which is Now calculate the estimated number of formula of and use the

Write a scientific explanation exploring whether offspring traits can be predicted when combining traits from parent genes Claim

cessive dion in the gene Flat snouted Hhss big ears You X hate two pigs genotypes and phenotypes hown below Big eared hhSs Part 1 Draw and fill in a Punnett square for this cross assuming that the H and S genes are unlinked assorting independently How many progeny classes are there and what are their genotypes phenotypes and relative proportions Note you will receive credit for any answer you enter into the textbox below these answers won t be scored for correctness but this is an important step for answering the final question you will use what you generate here to create the expected values for your chi squared test BIUT T I E Observed Part 2 Many years of crossing these pigs results in 400 piglets with the phenotypes listed below Note that this problem uses a short hand convention you will want to get used to if a mutant phenotype is not mentioned assume it is absent Therefore assume that the progeny described below as big eared have normal snounts Assume that the progeny described as flat snounted have normal ears 0 10000 Word Limit Wild type 146 Big eared 81 Flat shouted 86 Flat snouted big eared 87 Perform a chi square analysis to testing the hypothesis that the H and S genes are unlinked What is the value of chi squared and the corresponding p value Be sure to use your answers from part I regarding the expected proportion of individuals of each phenotype if the genes are unlinked As with Part I your entry in the textbox will be not be scored for correctness but you ll need to do this analysis to answer the question in Part 3 Expected 0 0 e

When true breeding mice with brown fur and short tails BBtt were crossed to true breeding mice with white fur and long talls bbTT all the F offspring had brown fur and long tails The F offspring were then crossed to mice with white fur and short tails bbtt The fur gene and the tail length gene are 7 cM apart Part 1 Which of the following F offspring are recombinant Select ALL that apply Hint Draw the chromosome arrangements for all three generations Brown fur long tail Brown fur short tail White fur long tail White fur short tail You need more information to answer this question Incorrect There is enough information to answer this question Notice that one of the P generation had brown fur and short tails BBtt and the other had white fur and long tails bbTT That means the F1 was BubT Therefore what type of F2 would show a new combination of traits compared to the F1 Part 2 Using the information given in Part 1 if there were 400 mice in the F generation how many do you expect would have white fur and long tails 372 O 186 75 28 25 O 14 x

wild type allele TSS gap Wild type expression Agouti O dominant negative O copy number variant O loss of function O gain of function Question 201 agouti viable yellow allele TSS Ectopic expression TSS IAP 99999 unmethylated CG sites The Agouti gene is a determinant of coat color in furry mammals such mice The wild type allele is expressed in the skin in a pattern that leads to the production agouti fur left drawing above The viable yellow allele has an insertion IAP upstream of the normal transcription start site TSS Depending on the methylation status of multiple CG dinucleotides within IAP this insertion can initiate transcription from an abnormal location near the insertion site with transcription reading through the Agouti gene at an elevated level and causing the production of yellow fur right drawing above Drawing adapted from Paro et al Introduction to Epigenetics Springer 2021 This is background information for questions 18 through 23 Wild type expression Agouti Yellow Which of the following classifiers of mutation type would you assign to the viable yellow allele with unmethylated CG sites in IAP 3 pts What fur color do you expect to observe in a heterozygote that has one wild type allele and one viable yellow allele with unmethylated CG sites in IAP

The Ras oncogene is activated by mutation of its proto oncogene precursor in about 30 of all human cancers Use the dropdown menus to indicate yes or no for several possible genetic or epigenetic changes in the Ras gene described below to indicate whether you would you expect to find this change in tumor cells where one of the drivers is a Ras oncogene Deletion of one copy of the gene Select V Methylation of CG dinucleotides in the promoter region Select A translocation that moves the coding region of Ras near a repressor DNA element such that Ras is not transcribed Select A missense mutation that causes Ras protein to be constitutively active GTP bound in the absence of activating signals Select A copy number variant that locally amplifies the Ras gene Select Acetylation of histones associated with the Ras gene Select

Wild type flies have gray bodies and red eyes A fly exhibiting the autosomal recessive traits ebony body genotype ee and brown eyes genotype bb is crossed with wild type to produce dihybrids Ee Bb and these are intercrossed A fly showing both dominant phenotypes is selected at random from the F2 population and crossed with a ebony body brown eye tester ee bb There are two progeny classes from that cross gray bodies and red eyes gray bodies and brown eyes What was the genotype of F2 fly used for the final cross described Ee BB OEE Bb Ee Bb

A man has ichthyosis an X linked recessive trait that causes him to have dry scaly skin all over his body His wife does not display the trait This couples daughter has patches of dry scaly skin but most of her skin is not dry and scaly Which of the following mostly likely explains the patchiness of ichthyosis in the daughter O Non disjunction O Haplo insufficiency O Translocation OX inactivation

Wilson s disease is an inherited disorder in which there is too much copper in the body s tissue It is inherited in an autosomal recessive manner Below are pedigrees from two families where some members of a family have Wilson s disease Neither Hillary nor Justin have Wilson s disease If they have a child what is the chance this child will have Wilson s disease I 11 III O 1 9 O 1 2 O 1 6 1 4 O 1 3 1 1 2 3 2 Hillary 3 5 Justin 6 7

p53 is a tumor suppressor gene mutations in p53 are seen in more than 50 of all cancers Which of the following mutations in p53 would likely increase cell division rate predisposing an individual to cancer Sort each mutation into the correct bin to identify it as more likely to be cancer causing or more likely to be non cancer causing A translocation that puts the p53 gene near an active repressor region of DNA such that p53 is not transcribed Duplication of the p53 gene Deletion of one copy of the p53 gene Methylation of CpG islands near the p53 promoter region A nonsense mutation close to the start codon of p53 such that no functional p53 protein is made A missense mutation in the p53 gene that increases the activity of the p53 protein Cancer causing Non cancer causing

Mutations in the adenomatous polyposis coli APC gene increase the risk of developing colorectal cancer The partial DNA sequences shown are on the coding strand of the APC gene from Jamal who does not have cancer and Jana who was diagnosed with colorectal cancer The sequences are in frame with the start codon not shown What type of mutation does Jana likely have Consult a codon table to answer this question Jamal 5 GAG GCG GGT TCA CGA GAG 3 Jana 5 GAG GCG GGT TGA CGA GAG O Frameshift O Missense Silent Nonsense 3

The A gene is autosomal A man with genotype Aa has a child with a woman whose genotype is AA Their child s genotype is Aaa and this child is viable What can be concluded Choose all that apply Non disjunction occurred in either meiosis I or meiosis II in the father cannot determine which stage Non disjunction occurred during meiosis I or meiosis II in the mother cannot determine which stage The child has Klinefelters Syndrome Non disjunction occurred during meiosis II in the father The child s genotype is euploid The child has Downs syndrome The child s genotype is aneuploid

The karyotype below shows chromosomes 5 and 12 for a family in which the child has a severe disease Mother Chromosome 5 12 Father 5 12 Child 5 12 Which of the following statements best describes the situation presented O The father has a mutation and a similar phenotype to the child the child inherited the mutation from the father The father has a translocation from chromosome 5 to 12 he is normal but the child inherited an incomplete chromosome 5 The father has a reciprocal translocation where chromosomes 5 and 12 exchanged material he is affected and has passed on the translocation to his child O The child has a deletion mutation that occurred spontaneously

2 A Drosophila fruit fly female lacking wing cross veins is mated with a male with normal wings with cross veins Female F progeny have normal wings but male F progeny have crossveinless wings a What explanation do you propose to account for this result Include a designation as to which trait is dominant and which recessive b One of the F females is mated with a male with normal wings What progeny phenotypes do you predict in what proportions c An F female progeny of the cross described in part b is chosen at random and mated with a crossveinless male This mating yields both crossveinless and normal winged flies What proportion of the offspring do you think had each phenotype and what were their sexes

Why is it important for scientists to share a standardized system of binomial nomenclature A So that people can use the organism s common name in place of its scientific name B So that disagreements about the common names of organisms will not occur C So that all organisms have a name based on the system that most people prefer Linnaeus s system D So that people from different places can easily share and obtain information about a species

How does natural selection affect the passing of traits to offspring A Parents acquire beneficial traits in specific environments and pass on those traits to offspring B Traits mutate with each generation to increase an individual s chances of survival in an environment C Every trait is passed on to future generations D Traits that are more beneficial are more likely to be passed on

In a typical neuron where do you find the voltage gated calcium channels along the entire length of the axon at the axon hillock on the dendrites at the axon terminals on the cell body

The nucleus and most of the organelles in a neuron are located in the axon Odendritic region cell body axon hillock axon terminals Question 11 1 point

Generally only female cats have the tortoiseshell phenotype for fur color Which of the following statements explains this phenomenon A male inherits only one allele of the X linked gene controlling hair color Multiple crossovers on the Y chromosome prevent orange pigment production The Y chromosome has a gene blocking orange coloration Only males can have Barr bodies

Which of the following statements is correct in describing the terms monohybrid cross and dihybrid cross A dihybrid cross involves organisms that are heterozygous for two characters that are being studied and a monohybrid cross involves organisms that are heterozygous for only one character being studied A monohybrid cross involves a single parent whereas a dihybrid cross involves two parents A monohybrid cross is performed for one generation whereas a dihybrid cross is performed for two generations O A monohybrid cross results in a 9 3 3 1 ratio whereas a dihybrid cross gives a 3 1 ratio

13 Can unprocessed antigen also make its way to lymph node B cells

A a homologous gene that arose through gene duplication B a derived form of a trait that is shared by a group of related species C D one of two or more homologous genes separated by a speciation event a poncoding stretch of DNA containing a string of short repeated segments

A diploid strawberry plant is crossed to an octoploid strawberry plant Select all of the correct statements below The resulting offspring would still produce haploid gametes This cross does not work because plants cannot be polyploid The gametes of the octoploid would be tetraploid following meiosis The resulting offspring would be decaploid The resulting offspring would be pentaploid

Watermelons may be either plain green or striped in color the fruit may be either long or round in shape A watermelon plant of a homozygous long green variety was crossed with one of a homozygous round striped variety The F1 plants all bore round green melons Answer the following questions by filling in the blanks with the correct number Use only numeric digits such as 1 2 3 etc Fractions should be written like 3 5 Ratios should be written as 7 7 or 7 7 7 7 Answers not in these formats will be marked wrong a How many genotypes are possible in the F2 generation 4 b What fraction of the F2 generation would be long and green 0 c In the F2 generation what is the ratio of green to striped melons 10 4 d In the F2 generation what is the ratio of round to long melons 12 4 e What is the probability of an F2 individual being round 12 16 fraction

Homework https ezto mheducation com ext map index html con con external browser 0 launchUrl https RNA primers are removed through enzymatic action to make two complete strands of DNA DNA is unwound at the A T rich origin of replication Helicases break the hydrogen bonds between the base pairs to unzip the helix Primase begins the new strands and DNA polymerase Ill adds nucleotides Single stranded binding proteins keep the strands separated Topoisomerases Overall direction of replication RNA primase ONA ANA DNA ge Saved Helicase Single strand binding proteins ONA polymera 3 5 1 2

A pea plant that has round seeds has the genotype Rr It is crossed with a pea plant that has wrinkled seeds and the genotype rr What is the probability that the offspring will have wrinkled seeds O 0 percent 25 percent O 50 percent O 75 percent

Pedigree B is most likely autosomal dominant What is are the genotype s of the parent s that transmitte the mutant allele s to their offspring Select all that apply AA Aa aa AY aY 4

Correct art B Previous Answers AA Aa Autosomal dominant Autosomal recessive X linked dominant O DO Pedigree C 00 DO OU DO Do 50 60 1866 Pedigree D DO OD 60 60 edigree A is most likely X linked recessive What is are the genotype s of the parent s that transmitted the mutant allele s to their offspring elect all that apply

Which of the following is NOT contained in an operon A termination genes C structural genes B operator genes D promoter genes

The active sites of the large subunit of rRNA are called P and A AT C S B B D E

Which of the following genetic code is NOT a stop codon A AGA C UGA B UAG D UAA

During DNA replication which of the following is NOT a function of DNA polymerase I A repair mismatches C excise abnormalities B reduce the error rate D build an Okazaki fragment

A In DNA the four nitrogenous bases can be grouped into two categories Cytosine and thymine are and adenine and guanine are cytokinases B pyrimidines C purines

Hershey and Chase knew bacteriophages contained only DNA and protein now they needed a way to each molecule A label and track B reveal the biochemistry of C make a copy D compare the densities of of

If the P1 is AABb x aaBb what is the probability of having an offspring that is aaBb A 1 4 B 0 C 1 16 D 1 2

A AaBbcc x AabbCc Considering the P1 above what are the chances that any of the offspring will show at least two recessive traits 3 16 B 318 C 9 16