The Living World Questions and Answers

Biology
The Living WorldThe region originally called "Persia" is based in which modern country?
A. Iran
B. Lebanon
C. Jordan
D. Egypt

Biology
The Living WorldIn Hinduism, what dictates a person's position in their next life?
A. karma
B. their current position
C. their parents position
D. prayer

Biology
The Living WorldThe earliest electronic computers were created in what decade?
A. 1920s
B. 1940s
C. 1960s
D. 1980s

Biology
The Living WorldSuppose your blood level of caffeine is 16 mg/L at noon. You ingest no caffeine after that, but at 6 p.m. you take a drug that alters your metabolism of caffeine so that from then on, its half-life is just half its normal value. What will your caffeine level be at 3a.m.? 
2 mg/L 
1 mg/L 
4 mg/L 
8mg/L

Biology
The Living WorldChoose the BEST answer:
Glycolysis is...
The first stage of aerobic respiration
The first stage of fermentation
It is the splitting of sugar and takes place in the cytosol
The first stage of anaerobic respiration
All the options are correct

Biology
The Living WorldSpinal interneurons prevent muscle antagonists from interfering with an intended movement by ...
initiating a stretch reflex
initiating a crossed extensor reflex
initiating a tendon reflex
the process of reciprocal inhibition

Biology
The Living WorldBefore the Spanish-American War, foreign policy of the U.S. was characterized by and after the war it was now seen as being
Social Darwinism, Imperialistic
Expansionism, Isolationist
Expansionism, Isolationist
Isolationism, Imperialistic
.

Biology
The Living WorldYou are following a written procedure in a laboratory manual. The procedure tells you to make 500 mL of a 1.5 gram per liter sugar solution. How many grams of sugar will you need to make this solution?

Biology
The Living WorldWhen considering dominant alleles, these alleles are most commonly explained by:
O a sequence change that makes a poisonous protein
0 a sequence change that expresses a protein with redundant function
0 a sequence change that causes a loss-of-function mutation
0 a sequence change that causes a gain of function mutation

Biology
The Living WorldSara and Mara are identical twin sisters. Their parents had them late in their marriage, and they have two older siblings. Their father was diagnosed with Huntington's disease, a dominant monogenic disorder, shortly after his 50th birthday. Their older siblings were also diagnosed with the disease late in life; their sister Tamara was 52 at the time of diagnosis and their brother Jack was 53 when he was diagnosed. Sara and Mara's mother never showed signs of the disease. Sara is turning 50 next year, and is very concerned about her chances of also having Huntington's disease. So she looked into her family records and found out that her father's mother had Huntington's disease but not his father. With her family information, Sara performed a Punnett square and found out she has a 50% chance of having Huntington's disease. Based on this information, what can you say about Sara and Mara's parents? 
Their mother's genotype is hh and their father's genotype is HH.
Their mother's genotype is Hh and their father's genotype is hh.
Their mother's genotype is HH and their father's genotype is Hh.
Their mother's genotype is hh and their father's genotype is Hh.
Their mother's genotype is Hh and their father's genotype is Hh.

Biology
The Living WorldIn bacteria, cells reproduce by dividing themselves to produce two daughter cells. Which one of the following statements is TRUE?
The parental cell goes through mitosis to give its chromosome to the two daughter cells.
The parental cell goes through meiosis to give its chromosome to the two daughter cells.
The DNA is replicated producing two identical copies of the linear chromosome.
The bacterial chromosome is shared via conjugation.
The DNA is replicated producing two identical copies of the circular chromosome.

Biology
The Living WorldWomen make less testosterone than men. Women who are heterozygotes for the balding trait (b) are not bald as adults. Men who are heterozygotes are bald as adults. A non-balding heterozygous woman has a baby with a balding heterozygous balding man. What is the probability that their baby will be bald in its adulthood?
The baby has 0% chance it will grow up to be bald if male
The baby has 50% chance it will grow up to be bald if male
The baby has 25% chance it will lose hair if female
The baby has 0% chance it will grow up to be bald if female
The baby has 25% chance it will grow up to be bald if male
The baby has 75% chance it will lose hair if female

Biology
The Living WorldIn Green-bellied snakes, G-green belly. g-brown belly. When a pure-breeding green-bellied snake is crossed to a pure-breeding brown-bellied snake, 100% of the F1 has green and brown stripes. This is an example of.
Codominance
Penetrance
Over-dominance
Complete dominance
Incomplete dominance

Biology
The Living WorldOccasionally, Drosophila flies are born with curly wings. Several of these unusual curly wing flies are crossed to one another with the following result: 522 curly wings, 266 normal wings. The mutation that causes curly wings probably: 
is recessive and semi-lethal in the heterozygote state
is dominant and semi-lethal in the homozygous state
is recessive and semi-lethal in the homozygous state
is dominant and semi-lethal in the heterozygote state

Biology
The Living WorldIn goats: Twild coat, t = long coat; C-produces large milk quantities, c- produces small milk quantities. Pure-breeding goats with wild coats and producing small milk quantities are mated with pure-breeding goats having long coats and producing large milk quantities. The F1 are then bred to one another. Assuming these traits follow Mendelian Inheritance and are unlinked, how many phenotypes do you expect to see in the F2? 
4
2
1
3
0

Biology
The Living WorldSarah and Bob are high-school sweethearts who have been married for 30 years. Sarah, who is Type A blood, has two children with Bob - Mary with Type O blood and Tim with Type B blood. Mary and Tim decided to sequence their DNA through 23andMe (a DNA Sequencing Company). While Tim's blood type alleles are I^B and i, Mary found out she has the alleles I^A and I^B. Based on the DNA sequencing data, what should be Mary's blood phenotype? 
Type O
Type A
Type AB
Type B

Biology
The Living WorldMAKING CONNECTIONS Hamilton also uses the example of Grecian republics to talk about relations with Spain and Britain. What is the similarity between the two?

Biology
The Living WorldThe expression of a gene involved in making anthocyanin (purple) pigment in pea flowers is controlled by a transcriptional activator. A point mutation in the gene encoding this protein results in a non-functional transcriptional activator, generating a loss-of-function allele. However, a heterozygote plant still makes purple flowers. Which statement below is TRUE?
The allele generated by the point mutation will be recessive to the wild-type allele. 
One wild-type copy is not enough. 
The mutant allele produces a blended trait. 
The allele generated by the point mutation will be dominant over the wild-type allele. 
You always need both alleles for a pea plant to have purple flowers.

Biology
The Living WorldIn sheep, the formation of horns is a sex-influenced trait, where the horns (h) allele is dominant in males but recessive in females. Females must be homozygous to grow horns. A horned male ram was crossed to an un-horned female sheep, and produced a horned female. What is the genotype of both parents? 
O Both parents were heterozygous 
O Father was either heterozygous or homozygous for the horned allele and the mother was heterozygous 
O Both parents were either heterozygous or homozygous for the horned allele 
O Father was either heterozygous or homozygous for the horned allele and the mother was homozygous for the horned allele 
O Father was homozygous for the horned allele and the mother was either heterozygous or homozygous for the horned allele

Biology
The Living WorldIn a mechanical lever system, concentric action of skeletal muscle is considered:
Internal (effort) force
External (resistance) force
Internal (resistance) force
Moment arm of resistance

Biology
The Living WorldIn France, The Battle of Somme was the bloodiest battle during WWI. it killed or wounded over 1 million men and it was the first time in history that this piece of military equipment was used.
a) Anti-aircraft missiles
b) Tanks
c) Rifles
d) Submarine


Biology
The Living WorldWhat is the most important question to ask when analyzing homologies to determine common ancestry?
Do they live in similar places?
Are the structures similar?
Do they have a similar function?
Do they eat the same foods?

Biology
The Living WorldExplain: How do organisms obtain and use the matter and energy they need to live and grow?
(Use Mealworm as a model organism to write response)
Molecules movement
How are atoms in molecules being rearranged into different molecules?
What is happening to energy?
Carbon movement
Answer:

Biology
The Living WorldWhich science process skill is used to make this statement: Somebody must have left the door open because the robber was able to enter the house.
Experimenting
Hypothesizing
Observing
Inferring

Biology
The Living WorldA patient with beta thalassemia major is developing an enlarged jaw because:
a. They are secreting too much growth hormone
b. The abnormal RBCs are infiltrating the tissue
c. Abnormal WBCs are infiltrating the tissue
d. Their bone marrow is being over-stimulated

Biology
The Living WorldThe term obligate refers to _____.
the ability to exist in a wide range of conditions
existing in a very narrow niche
using chemicals for energy production
using light for energy production
using oxygen for metabolism

Biology
The Living WorldWhat effect does studying with music have on student test scores? If... one student studies with music and one student studies without music then... because... music can be distracting to some students 
The student who listened to music will do worse on a test 
It depends on the student 
The student who listened to music won't show up to class 
Both students will do great

Biology
The Living WorldWhich best describes the activities of the Ku Klux Klan during the 1920s?
Successfully achieved control of both Congress and the Presidency.
Assisted Marcus Garvey in transporting African Americans "Back to Africa."
Were solely directed at prevented African Americans from voting in the South.
Saw its membership peak as it became a well-established, nationwide organization.

Biology
The Living WorldIdentify the INCORRECT statement regarding locomotion:
We have 2 CPGs, one for flexion & one for extension as a complete set for each leg
The swing phase starts only if the leg is not bearing weight, the hip is extended, and the opposite leg is in stance phase
As the heel strikes the ground, the mechanoreceptors will feed sensory information from your foot before you start the swing phase again
We have the stretch reflex, Golgi tendon reflex, as well as the extensor thrust reflex, and the output of these reflexes cannot be switched from flexion to extension

Biology
The Living WorldSkin cancer (Basal Cell Carcinoma) is caused by UV light striking the skin cells. The light can cause a mutation in the DNA of the basal cells. This mutation can happen in the gene called p53 which is a tumor suppressor gene.
Normal DNA:
TCAAGG CCCGAGAAATTGACCCATCCAGGTTT
Mutated DNA:
TCAAGG CCCGAG AAATGA CCC ATCCAG GTT
a. What type of mutation was caused by the UV light? Please put an asterick above the mutated DNA where the mutation occurred
b. What are 3 symptoms of Basal Cell Carcinoma?
c. What did the mutation do to the shape of p53?

Biology
The Living WorldThree students are discussing the nature of science. Below are their positions. Erika: Scientific understanding can change; in fact, the results of a single experiment can change an accepted scientific theory. Selvin: Science is a fixed and rigid discipline. Once a hypothesis is supported, it cannot be re-tested. Miguel: Science is an iterative process. Scientific understanding may shift over time given new data and findings across different sources. Which student has accurately described the nature of science? Enter the one-word name with correct spelling and capitalization. Do not add any extra spaces or punctuation. Type answer here. Be careful with spelling.

Biology
The Living Worlda tumor is initiated when:
Select one:
a. it has grown large enough to detect on an X-ray
b. its cells attract blood vessels to feed it.
c. its cells begin to grow more rapidly than normal in the GO phase
d. cells are exposed to something that causes genetic change in a proto-oncogene

Biology
The Living WorldWhich of the following is NOT a way that Jews were punished through antisemitism?
Expulsion
Pogroms
kidnapping their children
Ghettoization

Biology
The Living WorldWhat was an important effect of the Hundred Years' War?
England established permanent control over much of France.
The Black Death spread from France to England.
A greater reliance on new weapons reduced the importance of knights.
England and France failed to benefit from the Renaissance culture.

Biology
The Living WorldWhat is the significance of the Magna Carta (The Great Charter)?
It gave royal authority to the government.
It gave John the power of interdict.
It limited the power of the king.
It established King John as an absolute ruler.

Biology
The Living WorldWhich of the following best describes the Church during the Middle Ages?
It provided strong moral leadership
It grew weak and divided
It offered great comfort to people during hard times
It wielded little political power

Biology
The Living WorldWhat was a major cause of the Hundred Years' War?
The burning at the stake of Joan of Arc for witchcraft in 1431
The claims of King Edward III on the throne of France
The division of the French royal family in to the Bourbons and the Armagna's

Biology
The Living WorldWhat does this illustration show about a typical manor?
There were many factories and coal mines.
Secular values in society were stressed.
It was economically self-sufficient due to agriculture and trade.

Biology
The Living WorldA bond is formed when an electron is transferred from a sodium atom to a chlorine atom. What happens to the sodium atom during this process?
The mass of the atom increases.
The atom becomes an isotope.
The atomic number decreases.
The atom becomes a positive ion.

Biology
The Living WorldBiological anthropologists are interested in
how culture is learned from one generation to the next.
the emergence of human politics.
the impact of colonialism on different cultures.
archival data on the history of various cultures.
human evolution and contemporary human variation.


Biology
The Living WorldWhat was the chief goal of the Crusades?
To force the Byzantines to become Catholics
To improve trade among Europe, Asia, and Africa
To spread Christianity throughout Europe, Asia, and Africa
To recover Jerusalem and the Holy Land from the Muslim Turks

Biology
The Living WorldWhich of the following sentences with a
parenthetical expression is punctuated
correctly?
a) Nick, what time is football practice?
O b) Nick what time, is football practice?
O c) Nick; what time is football practice?
O d) Nick: what time is football practice?

Biology
The Living WorldThe river made a pleasant noise as it flowed through the rocks.
The writer revised this sentence to include personification. Which revised sentence shows an example of personification?
a) The river laughed as it danced over the pebbles.
b) The river wound through the forest like a train.
c) The river was a symphony.
d) The river was as quiet as a mouse.

Biology
The Living WorldThis biotechnology visualizes mRNA on a nitrocellulose membrane using nucleic acid hybridization
Eastern blotting
Southern blotting
Western blotting
Northern blotting
Central blotting

Biology
The Living WorldA pillory is a device used to imprison a person's head and hands, once used for public punishment. Read this quotation from paragraph 5 of the passage. "I got absolutely pilloried," says James. "I was on Today (a morning TV show) accused of killing the novel..." Which type of figurative language does the speaker use in this quotation? 
a) hyperbole 
b) idiom 
c) simile 
d) cliché

Biology
The Living WorldIf subjected to sound frequencies of 25,000 to 100,000 cycles per second, which of the
following would be least affected?
A. a porpoise
B. a house cat
C. a cheetah
D. a bat
E. a human being

Biology
The Living WorldCathie remembers feeling exceptionally exhausted and irritable every January. After years of
struggling with this "winter depression," Cathie went to talk to a physician about her health
concerns. She was diagnosed as having Seasonal Affective Disorder, or SAD. Millions of
Americans are also affected by this disease, which causes anxiety, fatigue, and food cravings.
SAD is associated with lower intensity and abbreviated periods of sunshine. The dark, gloomy
hours of winter along with the shortened days cause this disorder to be the most severe from
November through March. People who suffer from Seasonal Affective Disorder claim to find
relief with exercise and bright-light therapies.
Based on the passage, where in the United States would a physician encounter the most
cases of SAD?
A. southern Florida
B. northern Minnesota
C. eastern Virginia
D. western lowa
E. southwestern Arizona

Biology
The Living WorldWhich statement best describes how potassium bonds with bromine?
Potassium will donate an electron to bromine.
Bromine will donate an electron to potassium.
Bromine will donate seven electrons to potassium.
Potassium will share seven electrons with bromine.