Biomolecules Questions and Answers

Which of the following containers contains a liquid A O Container A O Container B O Container C B C

The particles of matter are expanding at all temperatures O not at rest O at constant rest O None of the choices

Question 2 Points 2 Gas molecules rotate or vibrate because the binding force between the gas molecules is O very strong O very weak O zero infinite

uestion Gases have Points Ono definite shape Ono definite volume Ono definite mass O no definite density

Identify the incorrect statement from the following O Applied heat energy increases the internal kinetic energy of matter O Gases do not have definite volume shape and mass O Gas particles have greater internal energy to overcome all the intermolecular forces O Solid particles are fixed at a point where they can only vibrate

Choose the correct order of states of matter based on levels of internal energy O Solid liquid gas O Solid gas liquid O Solid gas liquid O Solid liquid gas

ts 2 Which of the following statements is correct with respect to solids O They are compressible in nature O They are rigid and have no mass O They are rigid and have definite shape O They are not rigid and have mass

When heat energy is applied to the matter O it increases its internal energy O it increases the level of particle motion O the matter undergoes phase change all of the choices

According to the kinetic molecular theory the particles in the matter are in constant rest constant motion both constant rest and motion

Question 3 Think back to the presentation slide 2 How are Decisions Made In your opinion what are the three 3 most significant decisions the Athenians regularly made Underline the evidence to support your claim with a 1 2 and 3 that corresponds to your points

ent of cash flows The following cash data for the year ended December 31 were adapted from a recent nnual report of Alphabet GOOG formerly known as Google The cash balance as of anuary 1 was 12 918 in millions In millions 4 377 99 Payments on debt Proceeds from disposals of property and equipment Purchases of investments marketable securities Net cash provided by operating activities 92 195 37 496 60 695 Other net cash flows provided by investing activities Other net cash flows used by financing activities 3 921 adjusted for effect of exchange rate changes on cash and cash equivalents astructions enare Alphabet s statement of cash flow for Obj Net decrea in cas 2 20

Some characteristics of ideal gases are that they have a smaller volume than a real gas and there are no intermolecular forces Under all conditions ideal gases obey all the gas laws Real gases obey one or more gas laws depending on the conditions of temperature or pressure for example

1 The Ideal Gas Law is representative of ideal conditions not realistic ones What makes a gas ideal versus not ideal Explain or give examples

1 What is the cloning solution for kidney failure 1 Point dialysis cloning new blood cloning a new kidney cloning a sheep 2 What is the current problem with cloning 1 Point pig organs don t function like human organs it works so well we risk overpopulating species and overwhelming ecosystems few embryos survive

bodies being made up of water it is hard to not be aware of how important it is in our lives This simple fact is why scientists are constantly looking for water on other planets the presence of water could indicate the presence of life There are three different forms of water or H2O solid ice liquid water and gas steam Because water seems so abundant many people are unaware of the unusual and unique properties of water including Small range between boiling and freezing points Water s solid form floats on it s liquid form ice floats on water High surface tension high heat of vaporization and high vapor pressure Adhesion and cohesion Solid liquid and gaseous states all exist on Earth at the same time Read the information at these links before posting Properties of Water Discussion Questions Biological Roles of Water 1 Why are water s unique properties so important for life as we know it 2 Explain how hydrogen bonding accounts for many of water s unique properties Be sure to provide some evidence and the source for that

For this project you will be demonstrating a simple body novement we use every day What you will do is pick one rea of the body for example if you use both legs just break down one leg s movement Movements like walking hrowing sitting opening a door and many more can be used There is no wrong appropriate movement You will be using any software of your choice Google Slides Powerpoint Prezi Powtoon etc or creating a video using Canvas Studio See the project requirements below Introduction Name Project Name Period 1 Slide Explanation and Demonstration 1 2 Repetitions of the movement you picked 1 Slide Explain and Name the area of the body you are using Name and Point to muscles bones and joints being used Proper anatomical terms should be used ex Femur for thigh bone 1 2 Slides Describe the motions of each muscle involved that you have learned from Kinesiology Lesson 3 1 2 Slides

6 What role did the Committee on Public Information play during World War I What tactics did they employ to propagandize the American people into unquestionable support of the war effort 7 What were some of the motivations behind the Prohibition movement 8 In what ways did the government use the Espionage Act and the Sedition Act to suppress criticism of the war Who were the major targets of the Alien and Espionage Acts page 785 and 786 will help 9 What was Americanization Why did the government feel it was necessary 10 What were the flaws in Progressivism for black Americans

5 Who was Eugene V Debs 6 Who was Samuel Golden Rule Jones and what Progressive reforms did he contribute to America How did women earn the right to vote Why was the 19th amendment ultimately passed Today anti liquor laws are often thought of as conservative Why was prohibition regarded as a

When a bacterial cell is placed in a solution with higher solvent concentration and low solute concentration relative to it s cellular contents this osmotic possibility is isotonic O hypertonic

Singapore has a growth rate of 3 4 What can be said about the growth rate of the population in Singapore A It is exploding C It is improving B It is stable D It is declining

Match the following terms to it s best descriptor each descriptor should be used only once cytoskeleton Cell Theory hydrophobic ribosome 1 2 3 4 5 site that can store food pigments and toxins in plant cells all living cells come from other living cells composed of a double layer of phospholipids protein framework that provides support structure and transport the organelle that links amino acids together to form a protein 6 phospholipid tails point toward each other

mol per g wet wt caecal contents 120 100 80 60 40 20 0 H Acetate Obese oblob Lean ob 3 5 b Butyrate b Propionate 4 01 3 0 2 5 2 0 Lean Obese C Increase in body fat 60 40 20 0 Donor oblob Figure 3 Biochemical analysis and microbiota transplantation experiments confirm that the ob ob microbiome has an increased capacity for dietary energy harvest a Gas chromatography mass spectrometry quantification of short chain fatty acids in the caeca of lean n 4 and obese n 5 conventionally raised C57BL 6J mice b Bomb calorimetry of the faecal gross energy content kcal g of lean ob n 9 and obese ob ob n 13 conventionally raised C57BL 6J mice c Colonization of germ free wild type C57BL 6J mice with a caecal microbiota harvested from obese donors ob ob n 9 recipients results in a significantly greater percentage increase in total body fat than colonization with a microbiota from lean donors n 10 recipients Total body fat content was measured before and after a two week colonization using dual energy X ray absorptiometry Mean values s e m are plotted Asterisks indicate significant differences two tailed Student s t test of all datapoints P 0 05 P 0 01 p 0 001

What is the study of the interaction between humans and the environment called Population management Ecology Environmental science Data science

Identify the viral particles of this bacteriophage A Select B Select Select C C Select A B D

What domesticated animal was native to the Americas Elephants Cats Cows

pe your answer is an alternative to foraging and agriculture

1 3 points What species of animals were easily domesticated Select all that may apply Horses Chickens Elephants Cows Pigs

1 Research the 10 stages of genocide and in your own words describe what each stage represents Click here to access the Genocide Watch website

An undergraduate student obtained the DNA sequence shown below as part of a work study project in a lab Based on this DNA sequence how many ORFs does it possibly encode Explain your reasoning Write down the predicted protein sequence s 3 marks 3 5 ATATGTACGGTCATATTTACCCATAACTATT TATCATGCCAGTATAAATGGGTATTGATAA 5 3

Given the described mechanism of action for the drug Gleevec which statement below is true Gleevec is a non competitive inhibitor of the enzyme Gleevec is a competitive inhibitor of the enzyme Gleevec reduces the activation energy required for the enzyme to catalyze the reaction Gleevec is an allosteric regulator of the enzyme GEG

As stated in the video BCR ABL is a kinase A kinase is a type of enzyme that catalyzes the transfer of phosphate from one molecule to another What are the substrates for the reaction that BCR ABL catalyzes Select all that are true ord Substrate protein None of the listed molecules here ATP BCR ABL

Given the information that was just presented which of the following statements is true Select all that are correct Endothermic reactions have products with lower enthalpy Exothermic reactions have products with lower enthalpy Exothermic reactions have products with higher enthalpy Endothermic reactions have products with higher enthalpy K

203POCH2 OH cytidine 0 N N N N H NH deoxyguanosine 5 monophosphate deoxyadenosine 5 monophosphate

came the nucleosides or nucleotides HOCH 2 OH adenosine thymine guanosine OH N Z N NH N

5 How does a solution appear when it is positive for the presence of lipids

4 Which unknown s tested positive for more than one macromolecule

Question 10600 8 10800 11000 feet 10600 What is the contour interval of the USGS topographic map above Contour Interval

Which of the following topographic maps is the correct one for the profile below A B D

As mentioned previously evolutionary changes can be observed by comparing amino acid sequences of a protein that is common between the species of interest Point mutations as well as frame shift mutations may occur in the DNA which in tum affect the amino acid sequence of proteins To determine these changes specific regions of a protein may be examined and the amino acid sequence is aligned so that there are as few differences as possible between the species In some cases spaces are added to account for insertions or deletions to ensure proper alignment In this activity we will look at two regions Sequence 1 and Sequence 2 of the Cytochrome C Cytochrome C is a mitochondrial protein that is essential for aerobic respiration Therefore it is expected that the gene coding for this protein should be highly conserved Directions Determine the number of variants between each pair of species and record in the column of changes between species Using the data create a tree to denote the evolutionary relationship between the five species Remember there is neither a right nor wrong tree Sequence Cytochrome C amino acid sequence 14 21 Species 1 Macaca mulatta 2 Thunnus alalunga Candida krusei Amino acid sequence CSQCHT VE CAQCHTVE 1 3 5 CAECHET 1 4 2 3 4 Triticum aestivum 5 Helianthus annuus Draw the tree below CAQCH TV D 1 5 CAQCHTVE 2 3 Thunnus abrunga of changes between species 1 2 2 4 2 5 0 3 4 4 macaca Helianthus annus triticum aestivum Candida Krusei 3 5 4 5 Note H basic D E acidic C Q S T polar A V I hydrophobic outgroup 1 Based on the results of the amino acid sequences was the phylogenetic relationship of the species clearly evident Explain Yes it was evident because you were See which species were closes to each other 2 Based on your tree which species would be considered the basal taxon outgroup Candida Krusei is the basal taxon 3 In the sequence three of the amino acid positions interact with the heme group of cytochrom C which is critical to the function of the protein What are the likely positions Explain why

and sickle shaped red blood cells has weakness pain in the abdomen and joints swelling Patient Justin a 45 year old man who has started having jerky uncontrolled movements and trouble focusing his thoughts atient Jenny a 17 year old girl who has never had a mer f why ent Jessica vere obtained

Key Words abolish ah bah lish verb page 329 admonish ad mah nish verb page 308 coherent ko hir unt adjective page 324 TH conscientious kon she en shus adjective pages 313 325 controversial kahn trah vur shul adjective pages 327 330 naive nah ev adjective pages 310 325 pursue pur s verb pages 317 327 331 subdued sub dud adjective page 320 1 The mood in the library was quiet and 2 He decided to television 3 His mother too quickly She was very he d stay with her 5 Educationalists have called on the a career in 4 him for eating to believe that government to 6 They hold different opinions on issues like abortion tax on computers 7 The president has not presented a plan for dealing with it It is not clear at all and dedicated 8 Greg Smith is a worker who will be an asset to your company

If a hydrogen atom gives up an electron it will become a n O anion with one proton Ocation with one proton Ocation with one neutron O anion with one proton and one neutron D Question 34 Which of the following is a hydrophobic material O sugar W paper

The element present in all organic molecules O carbon O hydrogen oxygen O nitrogen Question 39 Why is carbon so important in biology OIt bonds to only a few other elements It has very little electronegativity making it a good electron donor It is a common element on Earth It can form a variety of carbon skeletons and host functional groups

Two atoms share two pairs of electrons Two atoms share one electron O One atom loses a pair of electrons to the other O Two atoms share two electrons Question 20 What results from an unequal sharing of electrons between atoms O a hydrogen bond O a polar covalent bond O a nonpolar covalent bond an ionic bond

O If two species are members of the same genus they are more alike than each of them could be to a different genus O Hundreds of individuals of a species have been observed and all are photosynthetic therefore the species is photosynthetic O If protists are all single celled then they are incapable of aggregating Question 12 A controlled experiment O includes at least two groups one differing from the other by two or more variables O includes at least two groups one of which does not receive the experimental treatment O includes one group for which the scientist controls all variables 2 pts

ar continued many Patriots lashed out at Loyalists or those who remained loya Great Britain during the Revolutionary War Read the passage from an editorial appearing the Pennsylvania Packet one of the first daily newspapers in America Then answer the question below Send the Loyalists where they may enjoy their beloved slavery to perfection send them to the island of Britain there let them drink the cup of slavery and eat the bread of bitterness all the days of their existence Never let them return to this happy land never let them taste the sweets of that independence which they strove to prevent Banishment perpetual banishment should be their lot What is the main argument in the passage Loyalists should be banished to Britain Patriots should take away Loyalists right to vote Loyalists should be enslaved Patriots should convince Loyalists of the value of independence

Human insulin consists of 51 amino acids divided into two chains of polypeptides Chain A contains 21 amino acids while chain B contains 30 amino acids How many nucleotides would be found in chain B of the insulin protein found in humans A B 10 90 C 45

A pre mRNA is shown in the image below Before the mRNA can leave the nucleus there are other modifications that must be made A 5 cap and poly A tail must be added to the correct ends of the pre mRNA CFTR A diagram of CFTR mRNA A B 1 2 C D 12 13 14 Which of the following best describes what would happen if the 5 methyl guanosine cap was not added to an pre mRNA 15 16 HAH 26 27 The mRNA molecule would not be able to add the poly A tail on its strand at the 5 end The transcript would degrade when the mRNA moves out of the nucleus to the cytoplasm The mRNA molecule would move out of the nucleus and create more copies of the mRNA molecule The mRNA molecule would stabilize and start the process of translation within the nu cleus of the cell

Osteoporosis is a condition in which the activation of certain signal transduction pathways causes calcium to be removed from bones leaving them brittle and more likely to break under moderate pressure Current research suggests that osteoporosis can be initiated under conditions of low cal cium intake in order to increase the availability of calcium for other biological roles in the body Which of the following describes the conditions that would be most likely to initiate osteoporosis A B C D insufficient amounts of calcium to be used in the fixation stage of the Krebs cycle in photosynthesis insufficient amounts of calcium to maintain the membrane potential established by the sodium potassium pump insufficient amounts of calcium to allow the replication of DNA molecules during cell division insufficient amounts of calcium ions to facilitate efficient transduction of neuronal signals

The maximal size of cells is primarily limited by which of the following properties A their surface area to volume ratios B C D the number of membrane bound proteins in their cell membrane the size of their subcellular components the surface area of mitochondria in their cytosol