Biomolecules Questions and Answers

identify and explain Martin Luther King I HAD A DREAM found to be the most persuasive and why Make sure to defend your claim using evidence from the speech and be specific in your analysis

NOTE In case you haven t clued in on this yet I want to make it crystal clear here with the following deductive argument 1 Different amino acids can participate in different types of intermolecular interactions 2 The intermolecular interactions that a protein can participate in thus depends on its amino acid composition 3 The intermolecular interactions that a protein can participate in ultimately determines its structure 4 The structure of a protein ultimately determines its function 5 The ultimate structure and function of a protein thus depends on its amino acid composition

The brackets are indicating a n 8 8 bond

What name is given to the bond between water molecules O O O O O Submit vide Feedback hydrogen single nonpolar covalent ionic hydrophobic polar covalent Request Answer

Yo preneres la comida o el postre el postre O prefieren O prefiere

3 Observe An organelle is a cell structure that performs a specific function Observe the samples below under the highest magnification Click the Show labels checkbox to label the organelles List the organelles and approximate size of the cells in each sample Sample Organelles 4 Mouse skin Fly muscle Maple leaf Elodea Fungus What do all of these samples have in common Estimated size m In eukaryotic cells genetic material is contained inside a distinct membrane bound nucleus Plant and animal cells are classified as eukaryotes Observe Click on the cow and observe E coli under the highest magnification Notico

If a buffer solution is 0 180 M in a weak acid K 6 2 x 10 5 and 0 520 M in its conjugate base what is the p DH

2 Search online and select an image of the ideal book bag backpack or tote bag you would send home with children in your class Copy the image of the bag and paste it into your assignment Cite the source of the image on your references page in APA format and explain in five to seven sentences which theme you ve selected and why Then share why you selected this particular bag to serve as your Healthy Take Home Bag 3 From the teacher s perspective write a letter to families of your students explaining what the bag is about and why their children are receiving the bag to take home In your letter include a greeting and closing and follow proper spelling punctuation grammar and formatting rules Your letter should motivate and excite families to receive the bag provide a detailed explanation of each item included in the bag suggest how to use each item appropriately and include any other directions suggestions or guidance you wish to express Before writing your letter imagine what questions concerns or apprehensions families might have as they receive the Healthy Take Home Bag Then include your answers and any additional information that might lessen their confusion or reluctance Manipulatives Describe at least one manipulative set you would include in the Healthy Take Home Bag Tell about the materials included and how they re to be used Then explain how the manipulatives extend the child s understanding of your selected theme This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Dramatic play Share ideas for costumes puppets or other dramatic play materials you would send home in the Take Home Bag Be specific by sharing the manufacturer s name of each item describing the items themselves and explaining how they ll be used Describe how the dramatic play items you ve included relate to your chosen theme and advance the child s understanding of your selected topic This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Sensory play Describe one sensory play experience you would include in the Take Home Bag to help teach children and families about your selected topic Explain how this sensory experience would benefit the family This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Science experiment Describe one age appropriate science experiment included In the Take Home Bag that supports your selected topic Explain the materials needed the steps of the experiment and the expected outcome Then explain how this experiment would benefit the family This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Recipes for healthy snacks Share at least one recipe for a kid friendly snack that s healthy nutritious and relates to the topic you ve chosen Identify the ingredients you would send home in the bag or expect the family to have on hand Describe the procedure of making the snack and explain how and why the snack contributes to the family s experience in learning together about the bag s theme This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Additional resources Provide at least one resource such as a website book magazine movie or other resource that would extend the family s exploration of your chosen theme Explain what the resource is and how it would benefit the family Make sure this is a credible source that families will find beneficial and easily accessible This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Science experiment Describe one age appropriate science experiment included in the Take Home Bag that supports your selected topic Explain the materials needed the steps of the experiment and the expected outcome Then explain how this experiment would benefit the family This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Recipes for healthy snacks Share at least one recipe for a kid friendly snack that s healthy nutritious and relates to the topic you ve chosen Identify the ingredients you would send home in the bag or expect the family to have on han Describe the procedure of making the snack and explain how and why the snack contributes to the family s experience in learning together about the bag s thems This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences han a website book

it throughout the school year It s contain important ideas and activities that provide families and children with knowledge about becoming and staying healthy and fit These bags allow family members to be involved in a child s learning Follow these steps to begin your assignment 1 Choose one of these four themes and plan your Healthy Take Home Bag around your selected topic a Germs Handwashing and Staying Healthy b Nutrition and Healthy Food Choices c Fire Safety and Emergency Preparedness d Dental Health and Hygiene Manipulatives Describe at least one manipulative set you would include in the Healthy Take Home Bag Tell about the materials included and how they re to be used Then explain how the manipulatives extend the child s understanding of your selected theme This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Dramatic play Share ideas for costumes puppets or other dramatic play materials you would send home in the Take Home Bag Be specific by sharing the manufacturer s name of each item describing the items themselves and explaining how they ll be used Describe how the dramatic play items you ve included relate to your chosen theme and advance the child s understanding of your selected topic This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Sensory play Describe one sensory play experience you would include in the Take Home Bag to help teach children and families about your selected topic Explain how this sensory experience would benefit the family This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Science experiment Describe one age appropriate science experiment included in the Take Home Bag that supports your selected topic Explain the materials needed the steps of the experiment and the expected outcome Then explain how this experiment would benefit the family This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Recipes for healthy snacks Share at least one recipe for a kid friendly snack that s healthy nutritious and relates to the topic you ve chosen Identify the ingredients you would send home in the bag or expect the family to have on ham Describe the procedure of making the snack and explain how and why the snas contributes to the family s experience in learning together about the bag s them This portion of your assignment is expected to be one fully developed paragrap of at least five to seven sentences Additional resources Provide at least one resource such as a website book magazine movie or other resource that would extend the family s exploratic your chosen theme Explain what the resource is and how it would benefit the family Make sure this is a credible source that families will find beneficial anc easily accessible This portion of your assignment is expected to be one fully developed paragraph of at least five to seven sentences Science experiment Describe one age appropriate science experiment include in the Take Home Bag that supports your selected topic Explain the materials needed the steps of the experiment and the expected outcome Then explain how this experiment would benefit the family This portion of your assignment expected to be one fully developed paragraph of at least five to seven sentences Recipes for healthy snacks Share at least one recipe for a kid friendly snack that s healthy nutritious and relates to the topic you ve chosen Identify the ingredients you would send home in the bag or expect the family to have on ha Describe the procedure of making the snack and explain how and why the sn contributes to the family s experience in learning together about the bag s thes This portion of your assignment is expected to be one fully developed paragra

2 Below is epehdrine metabolism On each arrow write the name of the enzyme responsible for th catalytic reaction HO NH Norephedrine OH CH NH 4 Hydroxynorephedrine CONHCH COOH Hippuric acid CH HN CH Ephedrine I CH CH OH COOH HO HO CH CH COOH

Use the Background information from the article to help you identify what is happening as rock undergoes changes Write the number from the diagram in the blanks to describe the activity in each part of the cycle 2 heat and pressure transform the rock layers melted rock crystallizes as it cools surface rocks break down due to weathering more extreme heat and pressure melt rock uplifting pushes rock to the surface compaction and cementation erosion processes transport the particles and deposit them as sediment

What do you think you would like to do after high school What skills are important to hone while in high school to prepare for your planned future What are your weaknesses as a student What are your strengths as a student How do you best learn For example auditory kinesthetic hands on visual independently in groups etc When you are lost or confused in class what are you most likely to do Is this helpful or productive to your learning

The passage discusses the importance of the discovery of the structure of the DNA molecule What did this discovery allow scientists to confirm O Specific base pairing allowed DNA to duplicate itself O If Chargaff s rule was followed then the bonds between bases were equal O Specific base pairing allowed for the transfer of genetic information the above

2 What are six signs of a chemical change 3 State whether the items below are physical or chemical changes Popsicle melting Sodium reacting with water and chlorine Folding paper A canister combusting A cracked glass 4 Look at the equation below Is this an endothermic or exothermic reaction 6 CO 6 H 0 sunlight C H O6 60 PS 3c Ionic and Covalent Bonds 1 When a nonmetal bonds with another nonmetal which type of bond is created 2 When a metal bonds with a nonmetal which type of bond is created 3 Which of the following is an example of an ionic bond a NaCl b H O c CH4 4 Which of the following is an example of a covalent bond a MgBr2 b AlF3 c 0 5 Electrons are shared in 6 Electrons are transferred in bonds bonds d N d Rb S PS 3d Conservation of Matter Counting Atoms and Balancing Equations 1 According to the Law of Conservation of Matter Mass the products and reactants must

37 Base your answer to the following question on the information below and on your knowledge of biology In a test for diabetes blood samples were taken from an individual every 4 hours for 24 hours The glucose concentrations were recorded and are shown in the data table below Blood Glucose Concentration mg dL Blood Glucose Level Over Time Time h 0 4 8 12 16 20 24 Blood Glucose Concentration mg dL 100 Example 110 128 82 92 130 104 Blood Glucose Concentration Over Time 14 16 18 20 22 24 0 2 4 6 8 10 12 Time h Plot the data from the data table Surround each point with a small circle and connect the points

8 45 01 24 38 lodine is the decolorizer in the Gram stain True or False True False Help S

Discussion Topic Viruses and bacteria can infect human cells Bacteria are living organisms while viruses are not How do you think the treatment for viral and bacterial illnesses differ How do you think they affect healthy body cells Explain your response

2 Scientists often work together with other scientists If you were working in a scientific laboratory how could you help people in your laboratory work together in a way that is effective and help make sure that people got fair credit for their work What is needed for people to work together in an effective way 10 points

SE2 Describe insulin biogenesis from translation to secretion Insulin biogenesis from translation to secretion

Incorporation of A ATP B dCTP C ddTTP PLASTP Put Name on Paper would result in chain termination during Sanger DNA sequencing

24 A ligand that resembles substrate affects catalysis by A noncompetitive B competitive C uncompetitive D irreversible E irretrievable inhibition

E TBP and TFIIB 10 A biomolecule or macromolecular assembly can be sedimented to equilibrium t A CAT scan B X ray diffraction crystallography C mri D mass spectrometry E ultracentrifugation

14 In the PDH reaction acetate is accepted by A OAA B 3 OH C S CoA D FAD E Niacin

17 The translocation step in translation depends foremost upon A a termination tRNA acylated to an amino acid B a chain terminating RT inhibitor C elongation factor G D fMet tRNA E TBP

An amino acid in a core histone protein which electrostatically bonds nucleosome subject to acetylation is A Trp B Lys C lle D Pro E Gln

4 The class of RNA most directly involved in translational decoding is A TRNA B miRNA C snoRNA D siRNA FloRNA

2 Pyruvate is converted to A CO and ethanol B propionate C succinyl CoA D lactate E alanine under anaerobic conditions in mammalian anacrobiosis

1 The pathway that produces ribose from glucose is A glycogenesis B glycogenolysis C glycolysis D pentose phosphate pathway E gluconeogenesis

Is this secondary xylem or secondary phloem Early wood vessel Hardwood or softwood Is this secondary xylem or secondary phloem Choose Choose

to your previous tests 33 questions x 2 embedded questions 66 points Question 87 In the Introduction to Food Macromolecules lab simulation you learned that contains lots of carbohydrates O broccoli O butter Orice O chicken 1 pts

Which has NOT been used as a cognitive behavioral treatment for Alzheimer s disease Odoing simple math and reading aloud in a group setting increasing the capacity of short term memory by memorizing strings of random numbers writing letters and attending cultural events such as concerts or plays using a computer based cognitive stimulation program

One symptom of Brianna s borderline personality disorder is a disorganized attachment style What does this mean She has difficulty identifying and controlling her emotions Her relationships with other people are hindered by her tendency to mentalize In her relationships with others she tends to be inattentive uncaring and dismissive Her relationships with other people are marked by anxiety instability and inconsistency

Here is part of a gene 3 GTAACCGTATTGCAGCTATTAGCAGC 5 CATTGGCATAACGTCGATAATCGTCG If the bottom strand of the DNA carries the gene write the mRNA that would be transcribed from this section of the gene

A hominin with an orthognathic face a chin and a forehead would be considered which species Homo neanderthalensis O Homo habilis O Homo erectus O Homo sapiens O Homo rudolfensis

When transferring culture to agar plates it is OK to have the plate uncovered for as long as you want because this will not interfere with your results O True O False

There are two general types of endoscopes they ar O Rectal and Oral Diurnal and Nocturnal O Robust and Fragile Flexible and rigid

The intermediate shown converts a ketone or aldehyde into what functional group Ph Ph Ph organophosphane O O alkene O alkyne 1 2 di ketone

19 2 points Botulinum toxin Botox is a neurotoxin that is produced by several species of bacteria and can cause paralysis Botulinum toxin prevents the synaptic vesicle membrane from fusing with the presynaptic membrane Which of the following processes would the application of botulinum toxin most directly affect A Arrival of the action potential in the axon terminal of the presynaptic membrane B Release of neurotransmitter into the synapse C Generation of a graded potential in the dendrite of the postsynaptic membrane D Generation of an action potential at the axon hillock of the postsynaptic membrane

6 2 points An example of the quaternary structure of a protein is A Hydrogen bonds between amino acid backbones in an alpha helix B Peptide bonds between amino acids in the backbone of a polypeptide C Disulfide bonds between amino acid side chains holding two polypeptides together D Hydrophobic amino acid side chains that cluster at the center of a folded polypeptide

7 2 points The structure of a molecule named estradiol is shown to the right Is estradiol able to pass through the phospholipid bilayer on its own HO H H OH H A No because it contains a majority of polar bonds and is therefore hydrophilic B No because it is a highly charged molecule and is therefore hydrophobic C Yes because it contains a majority of nonpolar bonds and is therefore hydrophobic D Yes because it is a large molecule and is therefore hydrophilic OH

2 2 points The figure below shows the structure of a biological molecule called ATP Which of the following functional groups is NOT present in this molecule A An amino group B A phosphate group C A carboxyl group D A hydroxyl group HO P O P OH OH OH OH OH NH

3 A short polypeptide sequence is shown below with amino acids numbered 1 through 3 from left to right On the image do each of the following HIN CH3 S CH 1 CH H N C C with nonpolar AAs with polar AAS with charged AAs HO 1 H OH CH N C C HO 2 H NH3 CH CH CH CH N C C OH HO 3 a 1 point Label the N terminus N and the C terminus C of the polypeptide b 3 points Identify each amino acid as nonpolar N polar P or charged C c 3 points Choose one of the three amino acids above 1 2 or 3 and circle the number below Then indicate which types of bonds or interactions it could form with each of the other classes of amino acids Amino acid 1 2 3 can form circle all that apply circle one NONE H BOND IONIC HYDROPHOBIC COVALENT NONE H BOND IONIC HYDROPHOBIC COVALENT NONE H BOND IONIC HYDROPHOBIC COVALENT

Short Answer 9 Questions Answer the questions in this section as completely and concisely as possible Make sure you answer the question that is being asked Extraneous information unrelated to the question even if correct will not earn points Spelling counts for technical terms You may use either pen or pencil 1 The diagram below shows the chemical structure of an ethanol molecule HH I H O H H 2 1 3 4 Li Be 1 0 1 5 11 12 Na Mg 0 9 1 2 II HH a 1 point Circle each of the polar covalent bonds present in this molecule There is a chart of electronegativities below 55 56 Cs Ba 0 7 0 9 b 1 point Draw a star at each possible location s where a water molecule could interact with ethanol c 1 point Name the type of bond that a water molecule could form at the location s you starred in part b Electronegativities 5 6 7 9 B CIN F 2 0 2 5 3 0 3 5 4 0 80 2 He 10 Ne 13 14 15 16 17 18 Al Si P S Cl Ar 1 5 1 8 2 1 2 5 3 0 30 31 32 33 34 35 36 19 20 21 22 23 24 25 26 27 28 29 Cr Mn Fe Co Ni Cu Zn Ga Ge As Se Br Kr 1 6 1 5 1 8 1 8 1 8 1 9 1 6 1 6 1 8 2 0 2 4 2 8 K Ca Sc Ti V 0 8 1 0 1 3 1 5 1 6 37 38 39 40 50 51 52 53 54 Rh Pd Ag Cd In Sn Sb Te 0 8 1 0 1 2 1 4 1 6 1 8 1 9 2 2 2 2 2 2 1 9 1 7 1 7 1 8 1 9 2 1 2 5 IXe 41 42 43 44 45 46 47 48 49 Nb Mo Tc Ru Rb Sr Y Zr

Match each item in the left hand column below with its definition or description in the right hand colum a a diverse group of microscopic organisms most of which are harmless or beneficial although a few can cause disease b process by which a seed sprouts c raw material that root bacteria capture from the atmosphere d a group of crop plants that includes barley and wheat e a beneficial relationship between two organisms f a nutrient that root bacteria produce which helps plants grow g a microorganism that causes strep throat 1 nodules 2 rhizobia 3 bacteria 4 Streptococcus 5 ecologist 6 nitrogen gas 7 ammonia 8 mutualism 9 grains 10 germination pyogenes h a scientist who studies how organisms interact with one another and their environment i a type of microorganism that normally lives on the roots of bean and pe j bumps of the roots of plants AKE PROOF Page 20 ECTIONS Answer the following questions in complete sentences hat is the epicenter of an earthquake ording to the article what led to most of the destruction of buildings in Haiti

specific observations O Inductive Reasoning Drawing Conclusions O Forming a Hypothesis Deductive Reasoning Question 100 are liquid at room temperature O None of these O Unsaturated Fats All Fats 1

a solution to a Hypotonic Isotonic O Hypotonic Hypertonic O Hypertonic Hypotonic Isotonic Hypotonic Question 74 These cut DNA wherever a specific nucleotide sequence occurs O Restriction Enzymes O Primers solution which allows it to follow its concentration gradient O Probes 1 pts

s in hydrake lipids 8 9 Period Part A Identify the specific molecule use the above terms from each description Some terms may be used more than once 13 2 Carlah ydyat es provides immediate energy 3 Profien sex hormones 4 5 6 7 10 11 Tipid s 12 14 provides long term energy storage for animals 1 Avocado Date provides short term energy storage for plants animal and plant structures forms the cell membrane of all cells speeds up chemical reactions by lowering activation energ one sugar many sugars forms the cell wall of plant cells Part B Label each food with the type of nutrient they primarily provide Carbohydrates Lipids Fats Protein 2 Cheese monomer of proteins provides long term energy storage for plants steroid that makes up part of the cell membranes provides short term energy storage for animals 3 Peanuts

27 What is the purpose of detergent dish soap in extracting DNA from strawberries a It precipitates the DNA from the fruit juice b It breaks down the phospholipid bilayer so the DNA can be released from the cell c To clean the strawberries before the experiment d To pull apart the sugar phosphate backbone of DNA

16 This phase of mitosis is the longest phase where chromosomes appear under a microscop a prophase b prometaphase c metaphase d telophase

How knowledge of macromolecule structure could translate to the knowledge of immune factors