Molecular Basis of Inheritance Questions and Answers

Imagine that you repeat the Benzer tRNA Selection experiment with modifications as follows 1 Synthesize mRNA containing U s and C s only poly UC in random order 2 Convert the amino acid Phenylalanine Phe on its tRNA to the amino acid Tyrosine Tyr as shown below 3 Mix your poly UC RNA your artificial tRNA and cell extract contains ribosomes amino acids all normal tRNAS and the energy source for translation Phe 5 Tyr 5 GAA GAA Phenylalanine Phe is encoded by UUU and UUC while Tyrosine Tyr is encoded only by UAC and UAU Given this and given what you know about tRNA selection will Tyrosine be found in the resulting polypeptides Assume translation will happen even without a start codon No because the ribosome selects the amino acid regardless of the anticodon sequence Yes because all of the normal tRNAs including tRNATyr are present in the assay Yes because the amino acid is selected based on the tRNA anticodon sequence None of the above

Mutant trp 1 trp 2 trp 3 trp 4 trp 6 trp 7 trp 8 trp 9 trp 10 Minimal medium Anthranilic acid 1 1 1 T Indole glycerol phosphate Indole T

C B D AGA E AO 36 template DNA strand GG PPS F H CC cell What is this location 77 What is the specific name of the entire molecule indicated by B 78 What do we call the process that is creating B 79 What is the large structure indicated by the letter C 80 The letter D refers to a specific molecule that is exposing the bases CCA What is the name of this entire molecule First base U UJUU UUC UUA UUG G CUU CUC CUA CUG AUU phenylalanine phe leucine eu GUU GUC leucine ou UCU UCC UCA UCG ACU AUC isoleucine de ACC AUA ACA A methionine met start ACO CCU COC CCA COG vaine val GCU GOC C GCA GOG Second base senine ser proline pro threonine thr alanine ala LAU LAC UAA stop UAG stop CAU CAC CAA CAG A tyrosine tyr AAU AAC AAA AAG histidine his glutamine gin asparagine asn lysine fys UGU cysteine cys UGC GGU GGC GAU GAC GAA GAG GUA GUG GGA GGG he codon chart to determine the identity of the amino acids indicated by E F and G on the picture above aspartic acid asp glutamic acid glu UGA stop UGG tryptophan trp G CGU CGC OGA COG AGU AGC AGA AGG arginine carg serine ser arginine arg DOAG UUR SOAG UCAG Third base glycine gly

2 Suppose the following sequence is found in mRNA 5 AUGCAGUGCUUUUGA 3 a Given that the AUG is a start codon draw a box around each codon in this sequence b What is the amino acid sequence of the polypeptide specified by this mRNA sequence Label its N and C termini c What are the specific anticodon sequences used in translating that polypeptide sequence Label their 5 and 3 ends assume no wobble

4 Sketch a double stranded region of bacterial DNA and the mRNA transcribed from the information in this DNA Label the following on your diagrams and state the importance of each for transcription and or translation 5 and 3 ends of the DNA strands Promoter 35 and 10 regions transcription start site 1 direction of transcription template DNA strand rho independent terminator 5 and 3 ends of the mRNA 5 UTR and 3 UTR Shine Dalgarno sequence protein coding region start codon stop codon

75 If a mother is a carrier for a sex linked gene and the father expresses the recessive sex linked trait then there is a 50 chance that their daughter will express the recessive phenotype True or False

C B 1 point Use the mRNA codon chart below to assign amino acids to the following mRNA sequence You may use the single letter abbreviations assume a start has already been added go from left to right A U G A U C A G U A C G UUU UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG U Phenyl alanine Leucine Leucine F L L UCU UCC Methionine M start codon UCA UCG CCU CCC CCA CCG ACU Isoleucine I ACC ACA ACG C Second Base Serine S Proline P Threonine T UUC Tryosine UAA UAG CAU CAC CAA A CAG Stop codon Stop codon Y Histidine G Glutamine Q H AAA AAG Lysine AAU AAC Aspargine N K UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC G Cysteine Stop codon Tryptophan W Arginine C Serine R AGG Arginine RA DO S Third Base

67 In which specific part of the female reproductive system would you find the process of fertilization taking place 68 Two homologous chromosomes will have the same locus for a gene True or False 69 Two chromatids that are separated from each other during meiosis 2 may not be identical to each other in every way True or False

How can databases of variants be used to help pinpoint a disease causing mutation Check All That Apply Some amino acids are conserved in genes across species mutations in conserved amino acids are not likely to cause disease Polymorphisms found in individuals that do not have the syndrome can sometimes be eliminated from consideration Common polymorphisms are unlikely to cause a rare disease and they can be eliminated from consideration Mutations that occur between genes are most likely to cause a genetic disease

2 The following diagram illustrates a step in the process of translation Identify the following elements on the diagram fMet pro UAC GGG AUGCCCACG UAG

In order to learn about the function of a gene scientists sometimes use a transgene to express the gene ectopically in the wrong place For example the fruit fly gene called eyeless was expressed by a transgene in some wing precursor cells The result was that the wings of the transgenic fly contained eyes indicating that eyeless causes cells to make eyes Check all of the materials listed below that you would need to make the ectopic expression transgene described Check All That Apply an enhancer active in eye precursor cells an enhancer active in wing precursor cells a cDNA for any gene expressed in the wing a cDNA for any gene expressed in the eye a mouse promoter a fly promoter

64 The allele for six fingers A is dominant over the allele for five fingers a What is the probability that two people who are heterozygous for this trait will produce a child with six fingers 65 Hemophilia is a sex linked recessive trait that only occurs on the X chromosome A child has hemophilia but their father does not Which of the following statements about this child is TRUE A They are male and could have inherited the trait from their father B They are male and could have inherited the trait from their mother C They are female and could have inherited the trait from their mother D There is not enough information to choose among the statements 66 Finish the sentence On the ribosome the A site will receive a tRNA that is carrying

Which of the following would be useful for monitoring the location of the gene X protein product protein X in an organism Check all that apply Check All That Apply Protein X made in the lab and then tagged with a fluorescent molecule Gene X mRNA made in the lab and then tagged with a fluorescent molecule An antibody to protein X tagged with a fluorescent molecule Gene X DNA tagged with a fluorescent molecule

Recall that sgRNAs for CRISPR Cas9 have a 20 nt sequence that is identical or nearly identical to a 20 bp sequence in the genome you want to modify Recall also that for Cas to cleave the DNA that 20 bp sequence must be followed immediately in the genomic DNA by the sequence 5 NGG which is called a PAM site Cas9 then cleaves both strands of DNA between the bases 3 and 4 bp upstream of 5 to the PAM site You are designing an sgRNA that will bring Cas9 protein to the following site in genomic DNA where you want to correct a disease allele by knocking in a wild type allele 3 5 TTCGCGTAAATTCGTCGTAACTCTAGGTG 3 AAGCGCATTTAAGCAGCATTGAGATCCAC 5 Which of the 20 nt sgRNA sequences shown will work Multiple Choice OS AUUCGUCGUAACUCUAGGUG 3 OS UUCGCGUAAAUUCGUCGUAA3 5 CGUAAAUUCGUCGUAACUCU 3 O 3 GCAUUUAAGCAGCAUUGAGA S

56 In which phase of mitosis would you find chromosomes loosening into their chromatin form 57 To what part of a chromosome does the spindle fiber attach

During lysogeny an inactive prophage state occurs when the viral DNA is inserted into the host chromosome host nucleolus host cytoplasm host nucleus host cell membrane

Biology Suppose that recessive deleterious allele is found to be much less common than its predicted equilibrium frequency based on the selection coefficient and mutation rate measured in modern populations Which of the following is the best explanation for this Note that when selection or mutation rates change it may take hundred of generations for population to reach its new equilibrium A Selection against the allele was weaker in the past than today B Mutation rates were higher in the past C Heterozygote advantage in some environments D Increases lifespans have made the allele more deleterious now than it was in the past

Which of these statements will corroborate confirm known information about transcription OARNA polymerase holoenzyme composes of five subunits that drive transcription in E col OB RNA transcription in bacterial and animal cells uses the same transcription factors and RNA polymerases OCRNA polymerase holoenzyme composes of six subunits that initiate transcription in E coli OD Answers A B and C are the right answer choices for this question OE Answers A and C are the right answer choices for this question

Directions Complete this concept map by choosing terms from the word bark and writing them in the correct spaces amino acids DNA instructions nucleic acid proteins RNA transcription units 2 3 5 1 is a type of Nucleic acid that coples coded from for the production of RNA 8 10 molecules translation constructs these molecules from proteins called amino acid in a process called

The astronaut Scott Kelly just returned to Earth after spending one year on the International Space Station NASA scientists wanted to know how life in space affects gene expression They therefore purified RNA from Scott Kelly s cells and compared the levels with those of his twin brother Mark who remained on Earth during the mission In order to determine which genes were misexpressed they would perform in order to convert the RNA to cDNA for sequencing In order to determine the amino acid sequences of any proteins encoded by any mRNAs in their mixture they would have to perform O Reverse transcription Blast Reverse transcription Conceptual translation OBlast Reverse transcription Conceptual translation Blast

The nucleotide A B T always pairs with A C G

1 Starlings sometimes assemble in large flocks that in the evening rise up in whirling flight together for 15 or 20 minutes in what looks like some kind of display V C Wynne Edwards suggested that this behavior is indeed a display that enables individual birds to assess just how many fellow starlings are living in the area so that they can adjust their breeding effort in the upcoming breeding season In this way they can avoid producing too many chicks and thereby avoid overpopulating their home range This a group selectionist hypothesis because A the idea is that starlings could evaluate the size of their local population or group B the flight behavior of the flock is something that cannot be explained in terms of any benefits to individuals and thus must be beneficial for the group C starlings do breed in such a manner as to avoid overpopulation D the suggestion is that the birds engage in costly behaviors in order to make decisions that are advantageous for other unrelated starlings

cells have acquired the ability to live in the presence of the antibiotic ampicillin then what might be interpreted about the other genes on the plasmid that you used in your transformation procedure 16 From the results you obtained how could you prove the changes occurred were due to the procedure you performed 17 What evidence do you expect to collect if you successfully genetically transform your rmat on w successful or not

Which of the following was NOT considered as evidence when comparing DNA and protein as being the genetic material A shape C biochemical language B polarity D internal bond type

The ligase is involved in ODNA replication ORNA processing O translation O gene regulation O transcription

Alfred Sturtevant expected crossing over to be less likely closer to the as the genes are more restricted A centrosome C chromosome B centriole D centromere

DNA replication results in two DNA molecules OA each with two new strands OB each with one new strand and one original strand C one with two new strands and the other with two original strands OD each with two original strands

Match the term with its corresponding definition F Genotype D Phenotype Wild type allele Mutant allele Dominant trait Recessive trait H Homozygous C Heterozygous Genetic engineering Genetic transformation A Normal allele B The process of inserting genes coding for new traits into a plasmid C Having two different alleles for a given gene D The observable physical and physiological traits of and organsim which are determined by its genetic makeup E Changed allele F The genetic makeup or set of alleles of an organism G The trait observed H Having two identical alleles for a given gene 1 Involves the insertion of a gene into an organism in order to change the organism s trait J the trait not observed but masked

40 Next a large ribosomal subunit binds to the small unit to make a functional ribosome The job of the ribosome is to hold the m RNA during translation Trve 41 Fill in the three bases that the t NA must have to attach to the mRNA given below AAG CUU GUC m RNA t RNA GGC UGU GCC

44 Let s start with DNA sequence for the synthesis of protein DNA ATG GGT AAT GTT TTC mRNA Codons tRNA Codons Polypeptide Amino acids USE THE CODONS ON THE m RNA TO SELECT THE AA s NOT THE ANTICODONS 45 DNA REPLICATION

With occasional exceptions most DNA comes from the maternal line A mutated C fraternal B endoplasmic reticulum D mitochondrial

If one strand of a DNA molecule has the sequence of bases 5 ATTGCA3 the other complementary DNA strand would have the sequence 3 TAACGT 5 O3 UAACGU 5 O5 UAACGU3

Which statement best describes DNA polymerase O It catalyzes addition of new nucleotides to the 3 end of a growing DNA strand O It is required to separate the strands for DNA replication It is an enzyme that keeps the replication fork open O It is required to glue pieces of DNA fragments together

4 If a female hemophiliac married a normal male what percentage of the offspring would be expected to have hemophilia

The enzyme involved primarily in polymerzation of new DNA strand core replication enzyme OA DNA polymearse III OB Helicase OC DNA polymerase I OD Primase

Shown below is a diagram of a eukaryotic replication bubble with only the template shown Where in the diagram will you find a leading strand Examine the template DNA very carefully before answering this question D min OA OB OC A B ay 5 3

Given your knowledge of how DNA is replicated which of the following DNA will be present after 100 generations in the Meselson Stah Experiment 50 N14 N14 hybrids and 50 N14 N15 hybrids All of the DNA will be N15 N14 Almost all of the DNA will be N14 N14 but a very small amount of N14 N15 will remain 25 N15 N15 50 N14 N15 25 N14 N14 All of the DNA will be N15 N15

If you performed the famous semi conservative replication experiment we learned about in class using the bacterium E coli and observed two bands after two generations as shown what is the composition of the band on the right the top of the centrifuge tube is to the left 14N 15N DNA hybrids 14N 14N DNA hybrids Single stranded 14 DNA 15N 15N DNA hybrids Single stranded 15N DNA

What does it mean to say that DNA replicates semi conservatively Some errors are made during DNA replication but these errors are usually repaired When DNA is replicated each daughter cell is 50 genetically identical to the parent cell and to each other When DNA is replicated the original parent DNA is inherited by one daughter cell and entirely new DNA is inherited by the other daughter cell When DNA is replicated both resulting molecules are comprised of one strand of original parent DNA and one new strand of DNA

12 Explain how the Hershey Chase experiment used bacteriophages with radioactive sulfur and radioactive phosphorus to demonstrate that DNA and not protein is the carrier of genetic information

GGGUUUCUACAGCGUGGAGAGGGUAUGAUCAAUAAAUACAAAAAAAAAA 1 IF ANY write the nucleotide sequence or sequences that is are not encoded in the DNA 2 IF ANY write the nucleotide sequence or sequences that will be NOT translated into a polypeptide 3 IF ANY write the nucleotide sequence that will be translated into a polypeptide ame TWO functions of the mature mRNA region or regions that is are not translated into a ypeptide

Which of the following statements about DNA synthesis at the replication fork of a replicating DNA molecule is FALSE A Nucleotides are added at the 3 ends of all the new strands in a replicating DNA molecule OB The sequence of each newly synthesized single strand is identical to that of the parental single strand that served as its template OC One of the two new strands must be synthesized in fragments because the two strands have opposite directionality D Double stranded DNA synthesis requires both deoxyribonucleotides and ribonucleotides

TRUE or FALSE The process of DNA replication DNA DNA involves complementary base pairing A TRUE B FALSE OC I don t know

TRUE or FALSE The process of Protein synthesis RNA protein involves complementary base pairing A TRUE OB FALSE OC I don t know 6

Use the genetic code from the table provided to identify the type of mutation that has occurred in the wild type sequence you translated above Choose among following mutations insertion frameshift mutation introducing a stop codon deletion frameshift mutation insertion frameshift mutation silent substitute mutation or substitute mutation Bear in mind that if the stop codon occurs as a result of a mutation this will result in the formation of a polypeptide chain that is shorter than the wild type chain you translated above Mutation 1 AUG UGU UAU GUC AUU CUU CUA UUG GUG GCG UAA Amino acids 17 Which type of mutation is mutation 1 Mutation 2 AUG UGU UAU GGU AUU CUU CUA UUG GUG GCG UAA Amino acids 18 Which type of mutation is mutation 2 Mutation 3 AUG UGU UAU GUU AAU UCU UCU AUU GGU GGC GUA A Amino acids 19 Which type of mutation is mutation 3 Mutation 4 Amino acids AUG UGU UAU GUU AUU CUU CAU UGG UGG CGU AA 20 Which type of mutation is mutation 4 Mutation 5 AUG UGU UGA UGU UAU UCU UCU AUU GGU GGC GUA A Amino acids 21 Which type of mutation is mutation 5

Odigia C3BC General Biology I BIO111 course content LAB ACTIVITY 1 INHERITANCE OF THE CORN TEXTURE GENE The corn used for this experiment F2 was obtained when smooth textured corn of the F1 generation were crossed with each other The F1 corn was obtained by crossing true breeding smooth textured corn with true breeding rough textured corn In this exercise you will be given a corn cob and you will count the number of corn kernels that have the smooth phenotype and the number that possess the rough phenotype The corn kernels represent the individuals of the F2 generation By doing this you will be able to determine how the corn texture trait is inherited 01 22 td BIO111 General Biology I 1 Write a hypothesis about how you think this trait is inherited in your statement include whether this trait is inherited according to Mendel s laws which phenotype is dominant and which one is recessive 2 Write a statement if then predicting your results based on your hypothesis hint in your statement predict what the phenotypic ratio will be based on your hypothesis 3 In table 2 below record the number of corn kernels that are smooth and rough Table 2 Number of kernels Lab 11 6 Texture smooth rough Number of Kernels 215 35

In the example below the DNA sequence is transcribed into mRNA which gets translated into protein DNA sequence mRNA sequence Amino acids Met Leu Leu Val Phe STOP STOP MEANS THAT NO AMINO ACID WILL BE CODED FOR BY UAA AND THE AMINO ACID SEQUENCE ENDS HERE 16 In the following exercise you are given the mRNA sequence transcribed from the following DNA sequence TAC ACA ATA CAA TAA GAA GAT AAC CAC CGC ATT Please translate this mRNA sequence into its corresponding amino acid sequence polypeptide chain Remember that proteins are long chains of amino acids Use the table at the end of the document and the follow example above to complete this exercise TAC ACA ATA CAA TAA GAA GATBAAC CAC CGC ATT DNA sequence Wild type mRNA sequence 01 22 dj TAC GAA GAG CAA AAA ATT AUG CUU CUC GUU UUU UAA Amino acid sequence AUG UGU UAU GUU AUU CUU CUA UUG GUG GCG UAA Lab 10 14 BIO111 General Biology I Use the genetic code from the table provided to identify the type of mutation that has occurred in the wild type sequence you translated above Choose among following mutations insertion frameshift mutation introducing a stop codon deletion frameshift mutation insertion frameshift mutation silent substitute mutation or substitute mutation Bear in mind that if the stop codon occurs as a result of a mutation this will result in the formation of a polypeptide chain that is shorter than the wild type chain you translated above

In the famous Hershey and Chase experiment 35S ended up in the supernatant after centrifugation What were they able to conclude from this result This means that the supernatant contains the DNA therefore DNA does NOT contain the code for virus production This means that the supernatant contains the protein and therefore protein contains the code for virus production This means that the supernatant contains the protein therefore protein does NOT contain the code for virus production This means that the supernatant contains the DNA and therefore DNA contains the code for virus production

According to the table below which of these two organisms are the most closely related Species Human Horse Gorilla Chimpanzee Zebra Region of Amino Acid Sequence LYS GLU HIS ILE ARG LYS HIS LYS LYS GLU HIS LYS LYS GLU HIS ILE ARG LYS HIS ARG Gorilla and Chimpanzee O Chimpanzee and Human O Human and Gorilla O Horse and Zebra

Heat killed Pneumococcus S cell extract that has been treated with RNase i e ribonuclease cells into S cells The conclusion that can be drawn from this is that Does RNA is NOT the transforming principle Does NOT RNA is the transforming principle Does RNA is the transforming principle Does NOT RNA is NOT the transforming principle does or does NOT transform R