Molecular Basis of Inheritance Questions and Answers

The pedigree below shows the inheritance of dwarfism in a family Is the trait dominant or recessive O Dominant O Incompletely dominant Recessive O The data is not sufficient to render a decition

What does the central dogma of molecular biology state a Energy flows from the sun to the cell b The total energy in the universe is constant c The structure of a molecule dictates its function d Genetic information flows from DNA to RNA to protein e The nucleus is the central site of protein synthesis

Question 3 Where does translation take place A nucleus B endoplasmic reticulum C golgi apparatus D ribosomes Question 4 Is mRNA single or double stranded A single B double me Question 5 What does the mRNA strand bin during translation A endoplasmic reticulum B golgi apparatus C ribosomes D mitochondria

Question 2 Before the mRNA leaves the nucleus for translation three modifications to the pre mRNA take place Select one modification that takes place from the list below A exons are spliced out B introns are spliced out C a poly G tail is added D an ethyl cap is added Question 3 What is the name of the sequence of DNA that signals the start of the gene

Level 3 Question 1 Three bases in DNA are called response 1 Three bases in mRNA a called a response 2 Three bases in tRNA molecule are called an respons 3 response 1 response 2

Question 6 The mRNA codon for valine is GUU what is the sequence of the anticodon A UAA B CAA C ACC D CTT Question 7 AUD What type of molecule is an anticodon found on A DNA ell B mRNA C tRNA UUA QUA A Jent

riwino Question 6 Which amino acid in eukaryotes does the start codon specify Question 7 et trukdo ob Transcription is initiated when the RNA polymerase binds to the A start codon B initiator

Bacteria has an operon that specifies encodes 6 proteins that allows it to take up residence in the body Expression of the operon is turned on ONLY when the bacteria has entered the body via the respiratory tract ie when bacteria is inhaled into the body Answer the questions 1 4 based on the information above and what you have learned about operons 1 What best describes the operon when the bacteria is growing on a slant or plate in the lab ie when the bacteria is not in our bodies a The repressor is NOT bound to the operator b Repressor is bound to the operator c Repressor is NOT bound to the promoter d Repressor is bound to the promoter e RNA polymerar

their proteins Based on what you have learned this chapter which of the following is most likely mechanism by which this occurs a infection causes the bacteria s ribosomes to be destroyed b infection causes the bacteria s mRNA to be destroyed c infection stops bacteria from modifying eg splicing editing its mRNA d infection stops DNA polymerase from binding to promoters e infection causes RNA polymerase to bind to promoters f infection causes repressors to bind to the operator region of operons

5 What are the two conditions that are needed for the lac operon to be expressed Which condition helps the RNApolymerase to bind to the promoter Which conditions removes the repressor gloco core shork he absent and kartose

18 Cells are differentiated because they have different produce different 19 A blood sample from a crime scene was determined to have 33 Cytosine a What percent of Guanine should the sample have b What percent of Thymine should the sample have c What percent of Adenine should the sample have that are turned or As a result they Their different proteins cause them to have structures and functions 20 Use the sequence below to answer the following questions TAC GCCTTAG CG CATAAT a Write the matching DNA strand b Transcribe the strand from a C Translate the mRNA you transcribed b d How many codons are found in this strand of DNA 22 10291413 SEME TUBER 21 Explain how a change in one nitrogen base can cause a serious problem for an organism an organism

Question 5 What is the name of the non c sequences of DNA that are splice before the mRNA leaves the nucl

1 Imagine you are a genetic counselor and a couple has come to you to learn more about their genetics and the effects genetic inheritance will have on their baby Describe which traits are inherited from parents and an explanation of how they are received from genes What are common dominant traits in a family Feel free to use your own family traits if you d like

Question 1 On which of the following molecules a codon found A transfer RNA B messenger RNA C ribosomal RNA D DNA Question 2 What is the name of the bond that join two adjacent amino acids in polypeptide chain

Question 8 If an mRNA nucleotide sequence was AAA the corresponding the tRNA would be anticodon on A TTT B CCC C UUU D GGG Question 9 Amino acids are arranged in a particular order in translation as they are attached to A DNA B mRNA C rRNA D tRNA Question 10 How many different amino acids are commonly found in proteins A 10 B 15 C 20 D 25 7

2 When the bacteria has entered the body via ingestion digestive tract the repressor should should not pick one bind to the Opera fill in space with choices below a Promoter b Reading frame c Operator d Terminator

Q4 After 50 generations the allele representing dark blue hair color approaches a fitness value of zero The alternative trait a hair color of light sky blue gets closer to a value of one What can be stated of the fitness level for this gene that codes for hair color

Which of the following is an example of the authentication using ownership O Fingerprint

Which of the following is not associated with translation O rRNA O mRNA O tRNA O DNA

Which of the following describes how steroid hormones regulate gene expression O They promote the degradation of specific mRNAs O They activate translation of certain mRNAs O They bind to intracellular receptors and alter transcription of specific genes O They bind to control elements in a regulatory gene and promote synthesis of that operon

address is the resolver s last step in the journey of O DNS recursor O Authoritative nameserver O Root nameserver

Discussion and Synthesis 11 The following image shows the steps in creating a DNA fingerprint Match the number to the description PCR amplification DNA extracted from tissue DNA fragments move across the gel DNA sample loaded into wells DNA stained with fluorescent dye Electricity applied to gel HEUROOD DO 6 2 VEN THE HOODD 11110000 Ma L 5 3 4

Highlight the second tRNA s anticodon the second codon and the second amino acid with the same color different from the first Arg UAC Met Pro GA Ser UCA AUGCCUAGUESGUAAA 10 Met Pro Ser AUGCCUAGUCGO GCC Highlight the third anticodon codon amino acid with a new color Do the same for the 4th C 2015 Bethany Lau AAAA 3 As the elongation phase continues the first tRNA without its amino acid moves into the E exit site The amino acid is now attached to the other amino acid attached to the second tRNA which has moved in the P site The A site is now open for the next tRNA to enter The next tRNA with the anti codon UCA aligns with the codon AGU in the A site The string of Met Pro attaches to the new amino acid Serine Ser when that tRNA moves into the P site and as the second tRNA enters the E site This process continues until the ribosome s A site detects a stop codon

Meb Lyr pro gly phe Soop b AUG AAG CCA GGC UUC UAA Pilet lys pro gly phe Les c AUG CCA CGA GCU UAU UGA Meb pro org ala bay Stop 019 19M 7 Look at 6a and 6b Compare the RNA sequences and the polypeptide sequences they code for What does this tell you about the third base in each codon Explain your answers below

C 2015 Bethany Lau 5 Met Pro GGA Translation Ma LENT ever Geir duom Ser www cup of be JCA AUGCCUAGUCGGUAAAAAAAAA Arg GCC 3

C 2015 Bethany Lau 5 Translation Met Pro GG Ser UCA Phase Arg GCC AUGCCUAGUCGGUAAAAAAAAA 3

Name Label the diagrams as you read the following passage 25 Phase Met Pro 5 Translation Part 4 UCA Ser Arg 26 27 AUGCCUAGUCGGUAAAAAAAAA 3 The termination phase begins when the stop codon reaches the A site At this point the completed amino acid sequence is attached to the tRNA in the P site The ribosome senses that the stop codon is in the A site and opens up letting go of the messenger RNA The tRNA releases the amino acid sequence and the protein folds into the shape it needs to be in to perform its function in the cell In this example a very short protein is shown But in reality the average human protein length is around 375 amino acids long After termination the ribosome waits until it bumps into another 5 methyl G cap of another mRNA mole cule and can begin producing a different protein The messenger RNA can also be re used by this ribosome or another ribosome to produce an identical amino acid sequence The tRNAs are recycled as well They will attach to their proper amino acids and carry them to another ribosome wherever their anti codon matches the codon Circle the stop codon Look back at your first 3 Translation pages and highlight the codons and amino acids they correspond to in the diagram above using the colors you used on the previous pages

Translation Part 1 Label the diagrams as you read the following passage 3 Met UAC 4 5 5 6 THAI 1 Date 8 11 GGUA B 10 9 AUGCCUAGUCGGUAAAAAAAAA talanez www 3 Translation is the process cells use to build new proteins using messenger RNA instructions The ribosome is a cellular structure that acts as the location for translation There are two types of ribonucleic acids RNA that are important for the translation process transfer RNA and messenger RNA Messenger RNA mRNA contains information from the DNA like a photocopy of one page from a giant book The messenger RNA has a 5 end and a 3 end just like a normal DNA strand The 5 end has a modified Guanine nucleotide that is called the methyl G cap This cap is important for the ribosome to find it and attach to the messenger RNA Remember ribosomes don t have eyes Ribosomes are large molecular structures that find their messenger RNA s by bumping into them and holding onto their methyl G caps The messenger RNA also has a poly A tail on the 3 end This tail prevents the RNA from being degraded too quickly In most cells there are enzymes called ribonucleases that float around in the cytoplasm and destroy any RNA that they come across Ribonucleases are important to destroy foreign RNA often viral RNA that happens to be in the cell The poly A tail on the messenger RNA helps to protect the rest of the messenger RNA from getting destroyed accidentally by the ribonucleases In between the G cap and the poly A tail the messenger RNA has triplets of nucleotides called codons The first codon on the 5 side always has the sequence AUG and is called the start codon The last codon before the poly A tail is called the stop codon and always has the sequences UAA UAG or UGA The codons in between can have any sequence except stops UAA UAG and UGA The start codons and in between codons are together like the recipe for a protein This sequence recipe tells the ribosome which amino acid to add together to build a new protein The stop codon tells the ribosome when to stop making that particular sequence Amino acids are carried to the ribosome by the transfer RNA tRNA the second type of RNA involved in translation The amino acid is attached to the top of the tRNA At the bottom of each tRNA there is a triplet of nucleotides called the anti codon During translation the tRNA with the anti codon that is complementary to the codon carries the amino acid to its correct spot in the amino acid sequence In this picture the anti co don AC will pair up with the start codon AUG and the tRNA will start the amino acid sequence with Met

C 2015 Bethany Lau Translation Met UAC www AUGCCUAGUCGGUAAAAAAAAA Phase MERULON 3 3

The central dogma of biology states that the process of O meiosis O PCR O transcription translation O evolution 4 is relevant to all of biolog

0015 Bethany Lau Translation Met Pro UCA Ser XArg Phase CO AUGCGUAGUCGGUAAAAAAAAA 3

In a DNA molecule the O backbone is composed of covalently bonded bases sugars are composed of 8 carbon rings O bases are hydrogen bonded to one another O adenine and cytosine base pair to each other

Which of these is heterozygous O AA O aa O Bb O both a and b

Transcription takes place in the nucleus O in the cytoplasm O on free ribosomes O in the rough endoplasmic reticulum

Following DNA amplification restriction enzymes gel electrophoresis the resultant DNA fragment band analysi called O cDNA PCR O DNA fingerprinting O vector analysis O gene therapy

A genome is O All of an organism s proteins Some of an organisms DNA O All of an organisms DNA O All of an organisms RNA

Transcription is the process that makes mRNA from DNA True False

Is the following statement true or false multiple ribosomes can bind to an mRNA at a time and synthesize polypeptides TRUE FALSE

O small satellite transmitters used in genetic research O known from Watson and Crick s 1950s research O useful for determining group but not individual identification O highly individualized repetitive stretches of nuclear DNA

Transcription occurs in the nucleus occurs in the ribosome results in the transformation of mitochondria results in the production of proteins

Is the following statement true or false All exons in a particular gene will always been included in the final mRNA transcript after splicing TRUE FALSE

Which of the following is the intermediate molecule formed before the covalent linkage of an amino acid to a tRNA O aminoacyl CoA O aminoacyl ADP

Which of the following are potential tRNA anticodons that would carry a serine amino acid written n 5 to 3 direction use Table 39 1 select all that apply First position 5 end U G AGA UCU CGU AGG U Phe Phe Leu Leu Leu Leu Leu Leu lle lle lle Met Val Val Val Val Second position A Tyr Tyr Stop Stop His His Gin Gin Asn Asn Lys Lys Asp Asp Glu Glu C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala G Cys Cys Stop Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly Third position 3 end U C A C UDUACUUAG

Interactions between enhancer binding proteins and RNA polymerase II that drive transcription are facilitated by which of the following type of protein O Cis acting elements Helicases O Transcription factors OTATA binding proteins

Is the following statement true or false The energy required for DNA helicase activity is provided by the hydrolysis of ATP to ADP O TRUE FALSE

Which of the following DNA sequences are not likely to be promoter elements select all that apply TTCCAAG

Is the following statement true or false The expression of constitutively expressed genes example enzymes in the glycolysis pathway are not regulated by proteins called repressors and activators that interact with genetic DNA TRUE FALSE

Which of the following statements concerning E coli polymerase I and polymerase III are incorrect select all that apply DNA polymerase III is more highly processive than DNA polymerase I ODNA polymerase III doesn t have proofreading activity DNA polymerase III removes primer RNAs from the DNA strand DNA polymerase I is more highly processive than DNA polymerase III DNA polymerase III has proofreading activity DNA polymerase I removes primer RNAs from the DNA strand

Phenylketonuria is a genetic disease in which individuals are unable to metabolize which amino acid Threonine O Phenylalanine Tyrosine Glutamine

1 The following nucleotide sequence is found on the template strand of DNA in the protein coding region of a eukaryotic gene 3 TAC ACG GCT CCA TGT ATT 5 3 TUUS a Write the amino acid sequence of the polypeptide encoded by this sequence using the 3 letter abbreviations for amino acids and labeling the N and C termini Show your work for example write the sequence of the transcript b Write the amino acid sequence of the polypeptide if the sequence above has a transition mutation at the gray nucleotide label the N and C termini Besides a transition mutation what term would you use to describe this type of base substitution mutation c In a separate scenario from b write the amino acid sequence of the polypeptide if the sequence above had the gra nucleotide deleted label the N and C termini