Molecular Basis of Inheritance Questions and Answers

Billy and Johnny are brothers but they do not look alike Which of the following factors contributed to this genetic variation asexual reproduction and binary fission cytokinesis and cloning crossing over and independent assortment DNA replication and mitosis

Step No 1 Step No 2 Step No 4 Step No 5 Step No 6 Question 5 6 Choose Choose That is the animal cell That is the bacterial cell Binary fission also duplicates the viral DNA Eventually two identical cells will synthesize bacteriophage particles Eventually two identical cells will synthesize the mutated DNA The bacteriophage inserts its DNA using the sheath Viral DNA incorporates into the host s DNA That is the protozoan cell The bacteriophage inserts its DNA using the capsid CHOOSE Choose

1 Think about how the trp operon of E coli is regulated by attenuation a When tryptophan is scarce what is the role of the Ribosome and tRNAs charged with trp trpl transcript RNA Polymerase b When tryptophan is abundant what is the role of the

6 Translate the mRNA strand into the corresponding amino acids using the chart provided 20 pts MMMARNANNA UC G G C C CC G First base U C U UUU UUC UUA UUG CUU CUC CUA CUG AUU Phe Leu Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU Second base C A Ser Pro UAU UAC UAA Stop UAG Stop CAU CAC CAA CAG AAU Tyr His Gin G UGU UGC UGA Stop A UGG Trp G U CGU CGC CGA CGG AGU Cys Arg U hird base 1 G

The first two questions refer to the following data A series of 5 auxotrophic the synthesis of a product called pr7 These are used to determine the biochemical pathway by which the cells make pr7 Minimal medium is supplemented with each of the following molecules and the ability of the cells to grow or not grow is determined Intermediate molecules in the pathway are given letters the genes coding for enzymes for each step are identified by the numbers of the respective mutant strain Strain 2 3 4 5 minimal medium min min D 11 1 min H 1111 min R 0 0 0 O min E 1 1 min pr7 O a HDER b EDHR c DHRE d RED H e none of the above 1 What is the order of intermediate molecules in this pathway the letters that would occur in the circled steps end product pr7 2 Which gene codes for the enzyme that is earliest in the pathway the enzyme catalyzing the step marked with a circle below a 1 b 2 c 3 d 4 e 5 end product pr7

5 Khorana devised a method of generating artificial mRNA molecules that could be translated to test the makeup of the genetic code If the dinucleotide sequence A C n where n is the number of repeats is translated what will be the amino acid sequence of the resulting polypeptide you can use amino acid abbreviations on the back of the scantron sheet UUU Phenylalanine UUC Phe UUA UUG CUU CUC CUA CUG AUU Leucine Leu Leucine Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU C Second base Serine Ser Proline Pro A UAU Tyrosine Tyr UAC UAA Stop codon UAG Stop codon CAU Histidine His CAC CAA Glutamine Gin CAG A AU Asparagine G UGU Cysteine Cys UGC UGA Stop codon UGG Tryptophan Trp G CGU CGC Arginine Arg MCAGUCAG CGA CGG AGU Serine Ser 9 Third base

QUESTION 8 Imagine that a chemical was released Place the following steps in order as th 1 Protein translation 2 Binding of the signalling chemic 3 Transcription factor activation 4 Activation of a series of cytoplas 5 Movement of the transcription f

anscription factor hancer TION 2 c operon which of the following best describes w e absence of lactose the active repressor binds t le lac operon the genr

1 If the mRNA produced by a certain bacterial gene has 50 G 10 U 28 A and 12 C nucleotides what proportion of the corresponding sense strand nucleotide bases will be purine on the back of the scantron sheet 2 How many sense codons amino acid coding are there in the genetic code on the back of the scantron sheet

19 The largest component of a chromosome by dry weight is a histone protein b DNA c RNA d non histone protein 20 Where would you find the molecule diagrammed at the right a eukaryotic transcription b prokaryotic translation c eukaryotic translation d prokaryotic transcription e in both prokaryotic and eukaryotic processes O C H N H H 1 O C C CH CH OH

13 If an artificial mRNA is synthesized with the nucleotide sequence 5 ACCC 3 repeated over and over again in tandem and then translated artificially in vitro how many different amino acids will the resulting protein contain The Genetic Code sheet is provided a 1 b 2 c 3 d 4 e more than 4 but less than 20

5 a True b False One factor influencing the binding of DNA to nucleosomes is the high proportion of amino acids that carry a positive charge in histones This gives the nucleosome an overall positive charge

The next three questions refer to events related to the diagram at the right The Exit site E is not shown 10 The gray arrow is pointing to which end of the mRNA molecule a 3 b 5 c there is not enough information provided to be certain 11 Before elongation can occur as is diagrammed here an incomplete ribosome plus other elements make up the initiation complex Which of the following is not part of this beginning initiation stage in prokaryotes a f Met tRNA b Shine Dalgarno box c small ribosomal subunit of the incomplete ribosome d AUG triplet on the mRNA molecule e large ribosomal subunit of the incomplete ribosome Peptidyl transferase Met Phe Leu bek UAC AAA AUG Juu 12 Which end of the polypeptide will correspond to the first translated codon a C terminal h terminal c P terminal d E terminal e A terminal ICIUIGI

8 There is no direct correlation between the amount of DNA and the developmental complexity of a given species because there is a lot of heterogeneity in eukaryotic genome makeup In the mouse genome data given in class for example denaturation and reassociation experiments yield CoT curves that show that the combined middle and highly repetitive DNA makes up approximately what proportion of the total genome a 50 b 70 c 5 d 2 e 30 9 Which type of histone is found in the nucleosome core a H1 only b H2A and H2B only c H1 H2A H2B and H3 d H4 only e all except H1

3 The wobble hypothesis applies to the base located at the a 5 end of the codon b 3 end of he codon c 3 end of the anticodon d both a and c e none of the above

6 a True b False Euploidy is having a chromosome number that is not an exact multiple of the haploid number as illustrated by the human condition Down Syndrome 7 The Shine Dalgarno sequence a helps prokaryotic RNA polymerase join the promoters of operons b helps mRNA to bind ribosomal RNA sequences in small ribosome subunits to initiate active translation c helps terminate transcription d helps insure proper linking of Okazaki fragments during DNA replication

Give the standard notation for a strand of DNA that is complementary to 5 CGGTA 3 AT FA Y BIU 000 T Y DO

If a hypothetical antibiotic drug inhibited amino acids from binding to RNA which type of RNA molecule would lose its function mRNA rRNA tRNA None of the above theloww

Quiz Instruction D Question 10 In transcription

CONCLUSIONS 1 Which type of mutation is responsible for new variations alleles of a trait 2 Which type of mutation results in abnormal amino acid sequence 3 Which type of mutation stops the translation of the mRNA 2 A geneticist found that a particular mutation had no effect on the protein coded by a gene What do you think is the most likely type of mutation in this gene Why 4 Examine your genetic code chart Name one amino acid that has more than one codon Name an amino acid that has only one codon 5 Look at the following sequence THE FAT CAT ATE THE RAT Delete the first H and regroup the letters in groups of three write out the new groups of three Does the sentence still make sense What type of mutation is this an example of 6 Given the following three mRNA sequences determine which two code for the same protein Circle them mRNA 1 mRNA 2 mRNA 3 Transcript AGU UUA GCA ACG AGA UCA UCG CUA GCG ACC AGU UCA AGC CUC GCC ACU CGU AGU Translate BONUS You have a DNA sequence that codes for a protein and is 105 nucleotides long A frameshift mutation occurs at the 85th base how many amino acids will be correct in this protein SHOW YOUR WORK

The template strand of a segment of double helical DNA contains the sequence 5 CTTAACACCCCTGACTTCGCGCCGTCG 3 What is the base sequence of the mRNA that can be transcribed from this strand 5 What amino acid sequence could be coded by this mRNA starting from the 5 end Enter the sequence using the one lett amino acid codes amino acid sequence If the complementary nontemplate strand of this DNA sequence were transcribed and translated would the resulting amino acid sequence be the same Why or why not No the complementary antiparallel strands in double helical DNA do not have the same base sequence in the 5 3 direction Yes the complementary antiparallel strands in double helical DNA have the same base sequence in the 5 3 direction Yes both an amino acid codon and its complement code for the same amino acid No the nontemplate strand contains a stop codon resulting in the production of a truncated peptide

The is a diagrammatic approach to keeping track of probabilities in a cross involving a large number of alleles O probability method forked line method Punnett square qualitative analysis

SimUText 2022 2023 File Edit Go Tools Help CONTENTS Section 4 An Extended Exploration The t Isle Ro Using the equation below plug in values for variances sample sizes to calculate SE and enter the value on th right And yes strangely enough you will divide by the sample sizes again SE 1 no n

here was recently a scientific article published discussing the higher incidence of skin cancer in red haired people They were investigating whether the alleles which produce these aits were an example of a phenomenon called Acceptable Formats Card or Cards or CARD Give me options

Tor a codon that calls for serin When a base pair is deleted o ESTION 9 of the following is TRUE regard

JESTION 1 w ach characteristic determine if it relates to Has uracil Use 5 carbon sugars

Exercise Question How do Mendel s Laws of Segregation and Independent Assortment relate to the process of meiosis

Principles of Complete the Punnett square for the following parental cross List the possible phenotypes and genotypes for each cross Each parent is heterozygous for tongue rolling Rr Rolling is considered dominant over non rolling The cross is written Rr x Rr Each parent can contribute two types of gametes Half of the gametes carry the R allele and half carry the r allele To fill in the square write the alleles that one parent can contribute along the side of the Punnett square Then combine the alleles from both parents inside each box The combinations of all alleles inside the boxes are the possible genotypes of the offspring Keep in mind that a Punnett square tells you the probable proportions of offspring genotypes not the guaranteed outcome Female R r What is the genotype of the mother What is the phenotype of the mother List all possible offspring phenotypes List all possible offspring genotypes What is the probability of getting tongue rollers R father father Male

If you were to compare the DNA following statements would be t Select one

Drag and drop the components of laws of inheritance to match with their description 1 Mendel theorized that are inherited as pairs of which behave in a dominant and recessive pattern 2 A dihybrid cross demonstrates when the genes in question are on different chromosomes or distant from each other on the same chromosome or probability methods to predict offspring genotypes and phenotypes rather than a 3 For crosses involving more than two genes use the 4 When genes are located in close proximity on the same chromosome their alleles tend to be inherited together This results in offspring ratios that violate Mendel s 5 Whether or not they are sorting independently genes may interact at the level of gene products such that the expression of an allele for one gene masks or modifies the expression of an allele for a different gene This is called Punnett square forked line independent assortment law of independent assortment genes epistasis alleles

Antagonistic interaction between genes such that one gene masks or interferes with the expression of another Phenomenon in which alleles that are located in close proximity to each other on the same chromosome are more likely to be inherited as a pair Result of a cross between two true breeding parents that express different traits for two characteristics Dihybrid Epistasis Linkano

Drag and drop the terms to their description to assess the understanding of characteristics and traits Gene variations that arise by mutation and exist at the same relative locations on homologous chromosomes Any of the non sex chromosomes In a heterozygote complete and simultaneous expression of both alleles for the same characteristic Underlying genetic makeup consisting of both physically visible and non expressed alleles of an organisat Observable traits expressed by an organism In a heterozygote expression of two contrasting alleles such that the individual displays an intermediate phenotype Autosomes Phenotype Incomplete dominance Codominance Allele Genotype 1

Drag and drop the terms to complete the concepts of Mendel s experiments and laws of probability 1 Working with garden pea plants Mendel found that crosses between parents that differed by one trait produced F offspring that all expressed the traits of one parent Observable traits are referred to a and non expressed traits are described as 2 crosses generated identical F and F 2 offspring ratios 3 To find the probability of two or more independent events occurring together apply the 4 To find the probability of two or more events occurring in combination apply the sum reciprocal recessive dominant product rule and multiply the probabilities of the individual events rule and add their individual probabilities together

Week 12 HW DNA Replication 2 of 2 Synthesis of the Leadi Part B RNA primers on the leading and lagging s The diagram below shows a replication bubble with sy synthesized DNA is light blue and the RNA primers as

ssessment take launch jsp course assess nutes 40 seconds atus

n drosophila the genes for scarlet eyes S normal s scarlet and curled wings C normal c curled are both on chromosome 3 and only 6 m u apart f you cross flies with the genotype SC sc and Sc sC what are the chances the offspring will be sc sc Clearly show your work 3 marks

2 A male rabbit with the genotype GGbb is crossed with a female rabbit with the genotype ggBb the square is set up below Fill it out and determine the phenotypes and proportions in the offspring gB gB gb Gb GB Gb gB Gb gb Gb Gb How many out of 16 have gray fur and black eyes gb 3 A male rabbit with the genotype GgBb is crossed with a female rabbit with the genotype GgBb The square is set up below Fill it out and determine the phenotypes and proportions of offspring GB Gb gB gb How many out of 16 have gray fur and red eyes How many out of 16 have white fur and black eyes How many out of 16 have white fur and red eyes How many out of 16 have gray fur and black eyes How many out of 16 have gray fur and red eyes How many out of 16 have white fur and black eyes How many out of 16 have white fur and red eyes

Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence assuming that the reading frame begins with the first three bases in each sequence Construct the peptides using the one letter codes of the ammino acids O Macmillan GGUCAGUCGCUCCUGAUU UUGGAUGCGCCAUAAUUUGCU

In drosophila the genes for aristaless antenna A normal a aristaless and held out wings H normal h held out are both on chromosome 2 and only 4 m u apart If you cross flies with the genotype Ah aH and aH Ah what are the chances the offspring will be ah ah Clearly show your work 3 marks

Worm Mel2 gene products are deposited into the egg by the mother and are required from embryonic development Mutations in the mel2 gene are recessive and cause maternal effect embryonic lethality In a cross between mel2 heterozygote males and homozygote mel2 mutant female what percent of embryos will die Explain the reasoning 2 marks

1 In pea plants round seeds are dominant over wrinkled seeds What combination of alleles must a plant have to produce wrinkled seeds 2 According to the summaries you wrote in your Science Notebook how is the genotype of a homozygous organism different from the genotype of heterozygous organism How is codominance similar to incomplete dominance How are the two types of inheritance different

In a genetic screen certain phenotypes are selected in a mutagenized population to unravel the function of a specific gene in a biological pathway genetic screen genes In a are identified based on a known phenotype whereas in a genetic screen the phenotype is analyzed based on known genes What are the two missing terms in the correct order sideways reverse forward sideways reverse sideways sideways forward forward reverse reverse forward

29 definition of a species is sm capable of breeding al or plant on Earth organisms with similar traits

Which action increases the rate of transcription in eukaryotic cells after RNA polymerase binds to DNA OA Transcription factors bind to the TATA box OB The ribosome is activated C The repressor protein is deactivated J D Transcription factors bind to enhancers

Describe the genotype of these d

ard My courses SC BIOL 100 3 Translocation during

My courses SC BIOL1000 N Biolog

Diet and nutrition are not a potential source of epigenetic modulation O False O True

An organism s A product An encompasses all of its genetic information is a specific sequence of DNA that codes for a particular trait protein or RNA is an alternate form of a gene A specific combination of alleles is an organism s those alleles is the organism s An organism s genes are arranged on for that trait while the physical expression of which occur in homologous pairs A cell with two of each chromosome one from the mother and one from the father A cell with only one chromosome of each homologous pair is called is called

Which statement best describes what it means when a gene is expressed A The gene that codes for the production of a protein is turned on B The gene is expelled from the cell when it is no longer needed C The gene produces all traits and functions within the cell D The gene is duplicated so it can be passed on to future cells