Anatomy and Physiology Questions

What is an example of Productive Aging O Kyle is retired but a month later gets a job at Walmart Darlin is retired and volunteers most of her time to the local youth center Sniff is 76 years old and is running for local assembly government position All are correct

11 12 13 ymphatic system

7 8

Lymphatic System 4 5

Complete the labeling activity in FIGURE 20 14 Write the answers in the numbered blanks Figure 20 14 Various types of lymphatic tissue 2 hon

3 Identify organs of the Lymphatic System mentioned below Torso model Spleen 24 Upper Head Model Palatine tonsil ball below soft palate y Pharyngeal tonsil adenoids x Lingual tonsil yellow at base of tongue z Thymus on heart model Lymphatic System Model initel lymph nodes

1 Review the Lymph Flow section 2 Fill in the flowchart to illustrate the pathway of lymph flow Lymphatic capillaries

Figure 20 3 Human torso model

Mrs Helms came in through the front door of her house with an armful of groceries She put the bag down on the kitchen counter and called to her husband Herb I m home Are you ready for lunch She didn t get an answer so she walked to the living room and found Mr Helms lying on the floor Herb Are you okay she asked as she grabbed his shoulder Mr Helms responded weakly while clutching his chest Mrs Helms frantically called 911 It only took EMS a few minutes to arrive and the paramedics transported Mr Helms to the hospital Upon admission to the hospital Mr Helms vital signs were recorded as follows Systolic blood pressure mm Hg Diastolic blood pressure mm Hg Oral temperature F Heart rate beats per minute Respiratory rate breaths per minute Oxygen saturation Questions Mr Helms 90 52 98 9 120 irregular 33 labored 89 Which of Mr Helms vital signs and lab values were abnormal Normal 120 80 97 8 to 99 1 60 80 12 to 20 95 100

Behavioral geneticists are interested in the heritability of certain traits e g IQ What is meant by heritability How would you describe this to someone with no background in psychology We discussed four types of theoretical frameworks last class Which framework do you think behavioral geneticists fall into How does this influence how we should interpret their findings

Top 3 Relationship Goals and Why 1 2 3 Top 3 Places to Visit Travel and Why 1 2 3 Top 3 Personal Goals Experiences

5 Step 2 Post on this discussion thread it will be graded on why the scientific process is so important to learning about the process of aging and also include any myths you think you might have been told about the aging process

What aging related research questions would you want to answer How would you examine these research questions using a longitudinal design Who will be your target sample How will you get your sample How are you going to measure your research questions What are some drawbacks things your design can t answer This will help you think about your interests in the field of aging Also this gets you on track to highlighting what you want to write your term paper on aka what area do to become a mini expert on at the end of this class you want

1 Take a picture of your current self 2 Under your picture paste pictures of things that provide you the most meaning in your current life no limit 3 Under each picture write a caption about a paragraph describing a Why this is meaningful to you b Why you want this to continue being a meaningful part throughout your life c How you can maintain the meaningful connection Notes After you have completed the assignment delete all instructions above so everything can fit on one printed page

I ve seen so many people with this one consuming goal of proving themselves in a learning setting in their careers and in their relationships BI EE Preview

This growth mindset is based on the belief that your basic qualities are things you can cultivate through your efforts B I 2 3 E Preview

Intelligence is probably the best measured trait that there is in all of human psychology says Duckworth BI EE Preview

JU we are on our way to evaluating whether they have the gra needed to succeed

When someone is ready for that challenge it s a wonderful ride

Answer the following in the space below 5 First answer for yourself then ask two people the same questions and write their responses below 5a What are your reactions to Kobe s Bryant death Your answer Their answer 5b There is no right or wrong answers but why do you think Kobe s life and death had such an impact on LA Your answer Their answer

1 You re braver than you believe stronger than you seem and smarter than you think Christopher Robin 2 There are no regrets in life Just lessons Jennifer Aniston

It doesn t matter how slow you go as long as you do not stop Confucius What lies behind you and what lies in front of you pales in comparison to what lies inside of you Ralph Waldo Emerson

Drag the appropriate labels to Spleen Lymphatic vessels Lymph nodes Tonsils Mucosa associated lymphatic tissue Thymus Lymphatic tissue and organs neir Heart Stomach Large intestine Small intestine MOONO Res

IS summoned to be A saviour if not an avenger how plain Comes the message O brothers Remember the Maine Lend your ear to the whisper tis growing more strong Tis a whisper no longer tis sweeping along Through the length and the breadth of this land of the free From city to mountain from mountain to sea And the voice of America tells thee O Spain That the men of our country Remember the Maine Arthur H MacOwen Which of the following best describes the Maine A ship sunk by the United States as a symbolic gesture in remembrance of those who died serving in the Spanish American War OA ship sent to Cube to protect American lives and property during the Second War for Cuban Independence The Main was an American trading vessell which was sunk by pirates off the coast of Spain It was later determined the pirates were act orders from Spain The Maine was the first United States battleship ever commissioned It was involved in transporting refugees to Farida during the Seca for Cuban Independence

What are your general reactions to the Graying of the World statistics and table p 372 in Textbook Table 9 1 Percent of United States Population 65 Years and Older Percent of United States 2012 2020 Population 65 Years and Older 13 7 16 8 4 5 5 4 3 2 4 4 2 4 3 0 1 8 1 9 85 Years and Older 1 9 2 0 Compiled from data from An Aging Nation The older population in the United States United States Census Bureau http www samsus mx prod 2014pubs p25 1140 pdf 65 69 70 74 75 79 80 84 America Japan Germany Italy Canada Russia The Graying of the World Even though the United States is aging it is still younger than most other developed countries Ortman Velkoff Hogan 2014 Germany Italy and Japan all had at least 20 of their population aged 65 and over in 2012 and Japan had the highest percentage of elderly Additionally between 2012 and 2050 the proportion aged 65 and over is projected to increase in all developed countries Japan is projected to continue to have the oldest population in 2030 and 2050 Table 9 2 shows the percentages of citizens aged 65 and older in select developed countries in 2012 and projected for 2030 and 2050 Table 9 2 Percentage of Citizens 65 years and Older in Six Developed Countries Percent of Population 65 2012 2030 2050 and Older 13 7 24 20 20 16 5 13 Figure 9 1 Age is Increasing Worldwide Compiled from data from An Aging Nation The older population in the United States United States Census Bureau http www census gov prod 2014 25 1140 0 Source 20 3 32 2 372 2030 25 5 25 20 20 3 5 6 5 2 4 1 2 9 2 5 22 40 30 According to the National Institute on Aging NIA 2015b there are 524 million people over 65 worldwide This number is expected to increase from 8 to 16 of the global population by 2050 Between 2010 and 2050 the number of older people in less developed countries is projected to increase more than 250 compared with only a 71 increase in developed countries Declines in fertility and improvements in longevity account for the percentage increase for those 65 years and older In more developed countries fertility fell below the replacement rate of two live births per woman by the 1970s down from nearly three children per woman around 1950 Fertility rates also fell in many less developed countries from an average of six children in 1950 to an average of two or three children in 2005 In 2006 fertility was at or below the two child replacement level in 44 less developed countries NIA 2015d 31 26 5 26 In total number the United States is projected to have a larger older population than the other developed nations but a smaller older population compared with China and India the world s two most populous nations Ortman et al 2014 By 2050 China s older population is projected to grow larger than the total U S population today As the population ages concerns grow about who will provide for those requiring long term care In 2000 there were about 10 people 85 and older for every 100 persons between ages 50 and 64 These midlife adults are the most likely care providers for their aging parents The number of old requiring support from their children is expected to more than double by the year 2040 He Sengupta Velkoff DeBarros 2005 These families will certainly need external physical emotional and financial support in meeting this challenge Life Expectancy vs Lifespan Lifespan or Maximum Lifespan is referred to as the greatest age reached by any member of a given population or species For humans the lifespan is currently between 120 and 125 Life expectancy is defined as the average number of years that members of a population or species live According to the World Health Organization WHO 2019 global life expectancy for those born in 2019 is 72 0 years with females reaching 74 2 years and males reaching 69 8 years Women live longer than men around the world and the gap between the sexes has remained the same since 1990 Overall life expectancy ranges from 61 2 years in the WHO African Region to 77 5 years in the WHO European Region Global life expectancy increased by 5 5 years between 2000 and 2016 Improvements in child curial and see to anticeluial medication for the

I am the military governor of Puerto Rico who restricted access to alcohol and tobacco and tried to teach Puerto Ricans English I also limited freedom of the press Who am I O George Dewey Jose Marti O Luis Munoz Rivera

Carry out some research and begin by next lesson A i Describe the 3 main types of muscles stating where each is found iii State what controls the action of each of the 3 types of muscle ii What are the similarities and differences between them Musculos answering the following questions to osteoporosis B i Describe what you understand by the terms osteoarthritis and hypothesis of osteoarthritis is based on evidence ii Research and explain whether or to what extend the wear and tear C Describe the meaning of the following terms including an example from the body where possible Flexion Extension Abduction Adduction Circumduction Rotation

Drag the appropriate labels to their respective targets Use labels of Group 1 for descriptions and labels of Group 21 more than once site of T cell maturation specialized clusters of partially encapsulated MALT in throat made up of lymphoid follicles nodules Name of Organ Lymph nodes MALT Spleen Thymus filters the blood for pathogens Tonsils located in the mediastinum and is composed of two lobes each containing many thymic lobules Description Group 1 Group 1 Group 1 Group 1 kill pathogens entering the screen and filter the lymph for body pathogens Group 1 consists of red and white pulp red pulp contains macrophages while white pulp contains leukocytes Function composed of B and T lymphocytes and found Group 2 Group 2 Group 2 Group 2 Group 2 small encapsulated structures that contain lymphocytes macrophages and dendritic cells Reset Help throughout the gastrointestinal and respiratory tracts

Which of the following is the best approach to gathering information related to a sensitive topic from a client Encourage the client to fully share so that appropriate programming can be developed Don t worry about sensitive information as it will make the client uncomfortable and decrease adherence Tell the client a story of another client with similar issues Gather information in pieces throughout programming

vity Drag the appropriate labels to their respective targets Use labels of Group 1 for the tissues or organs and labels of Group 2 for the structures capsule medulla cortex trabecula medullary sinuses lymphoid follicles lymph node thymus Group 2 Group 2 Group 2 Group 2 B3 Group 1 Group 2 Group 1 Group 2 Group 2 Reset Help

Please answer the following question in complete sentences in the textbox How does webpage design apply to the functionality of a website

These were assaults ordered by Attorney General Mitchell Palmer on suspected radicals after World War 1 They were controversial because of the lack of evidence that was needed to carry them out This act made the use of disloyal profane scurrilous or abusive language about the United States government its flag or its armed forces illegal This was a 1917 Act passed after entering World War I that made it a crime to pass information that would interfere with the success of the US Armed Forces This was a secret society organized in the South after the Civil War to reassert white supremacy by means of terrorism fell from prominence after Reconstruction but was reborn in the 1920s and remained powerful through the 1960s This was the period after each world war which saw massive upheaval in the U S and fear of many foreigners It was characterized by widespread fears of Communist influence on U S society and Communist infiltration of the U S government Palmer Raids Ku Klux Klan Sedition Act Red Scare

Identify whether the item led to the Boom of the 1920s economy or was a reason for the economic Bust that resulted in the Great Depression Boom Growth in the availability of electricity and technology Over speculation in the Stock Market Bust Laissez faire economics Rising Stock Market prices Assembly Line

Choose all of the statements that correctly describe the work of Henry Ford A B C D LL invented the minimum wage invented the assembly line low costs meant his cars were more affordable developed the mass production of the automobile invented the first horseless carriage automobile

Which of the following experiences associated with identification does NOT accou for political differences Race Gender Last name

Researchers conducted a study to determine whether magnets are effective in treating back pain Pain was measured using the visual analog scale and the results given below are among the results obtained in the study Higher scores correspond to greater pain levels Is this study an experiment or an observational study Explain Reduction in Pain Level After Magnet Treatment n 20 x 0 488 s 0 963 Reduction in Pain Level After Sham Treatment n 20 x 0 441 s 1 39 Choose the correct answer below 10 OA The study is an experiment because subjects were given treatments OB The study is an observational study because the subjects are a simple random sample OC The study is an observational study because there was no attempt to modify the individuals being studied OD The study is an experiment because the subjects are a systematic sample

Identity which of these designs is most appropriate for the given experiment completely randomized design randomized block design or matched pairs design Currently there is no approved vaccine for the prevention of infection by West Nile virus A clinical trial of a possib vaccine is being planned to include subjects treated with the vaccine while other subjects are given a placebo The most appropriate design is completely randomized matched pairs design randomized block

When DNA sequences are used for phylogenetic analyses each nucleotide position can be considered a trait Using the data provided below 57 bases from the mitochondrial DNA sequences of three chameleons and one lizard map ONLY the synapomorphic traits onto the phylogenetic tree provided below Note the horizontal branch on the tree where each trait transition takes place by using a line and the number of the base base numbers can be determined using the 10 50 marks above the sequence As an example of how I want you to map the traits onto the tree I have chosen a trait that is NOT synapomorphic and mapped it onto the tree position 10 the trait in question is an A in the lizard and two species of Brookesia and transitions to G in Chamaeleo After mapping all of the synapomorphic traits count the total number of trait transitions required to support this tree and note this number next to your tree If you are not sure which traits are synapomorphic read the material in the tan box that starts on page 214 of the text and is entitled Phylogenies from DNA sequences NOTE the tree only shows the three chameleon species leaving out the lizard Uromastyx outgroup that is included in the DNA data so you can evaluate which base is ancestral for each position Uromastyx B theili B brygooi C feae 10 20 1 30 40 50 AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT Brookesia theili Brookesia brygooi

Match the viral structures with functions as you did for Part I What is a virus protects the viral particle from immune recognition and is involved in attachment to the host cell may be RNA or DNA single or double stranded blueprint for new viral particles 0 Made of proteins protects the viral genome Attachment and entry into host cell 1 Protein Capsid 2 Envelope Glycoprotein 3 Lipid Envelope 4 Viral Genome

CB CB Ha 70 old Ap Nf CB CB CB SM IV CH Ga CB CB N SM IV Ta NI SM IV Ga SM II T3 Ga

dentify and share what you feel is the most important takeaway is in this module on building dreams and setting goals

What is a fixed mindset What is a gro mindset Why is this information impor to understand Edit View Insert Form

changes tissulaires gaz nutriments d chets hormones cellules Le plus souvent M tart rioles Capillaires

Figure 18 5 Blood vessel model 2 Lumen Artery subendothelial layer Venous valve 3 5 6 8 9

Dinoflagellates Protozoans Helminths Entamoeba histolytica Plasmodium vivax Trichinella spiralis Enterobius vermicularus Cysts Choose Multicellular parasitic worms that belong to the Kingdom Animalia A pinworm that causes intestinal disease diagnosis can be made by identifying eggs from feces microscopically A specific Protozoan that can form cysts A helminth that causes disease most commonly associated with undercooked pork A life cycle of some Protozoans that are resistant to environmental conditions and many types of disinfectants Unicellular eukaryotes that live in water and do not directly cause human disease Members of one particular genus cause Unicellular eukaryotes in the Kingdom Protista that can be found in water soil and as a part of our normal flora Some have the A specific Protozoan that is the causative agent of malaria Choose Choose Choose Choose Choose

Multiple choice Choose only one answer Yeasts are Ofilamentous single cellular filamentous multicellular O round single cellular O round multicellular

Multiple choice Choose only one answer Microscopically molds are identified by O long filaments hyphae O Gram stain reaction colony characteristics round budding cells

Which statement best describes the Great Depression After a period of economic growth in the US the economy experienced a severe recession triggered by the stock market crash in 1929 A rapid growth in the US stock market from 1929 1937 O O O A slow shrinking of the stock market and US Economy from 1941 1954 A period of time after WWII that led to the Cold War

Why did people blame President Hoover for the Great Depression he directly caused the stock market to crash people believed that he didn t do enough to help he encouraged people to use credit people believed that he did too much

Overproduction under consumption and the Stock Market Crash caused The election of Herbert Hoover The Second Great Awakening World War 2 The Great Depression