Biology Questions

Which Act was passed in 1973 to protect individual species whose population numbers had fallen to near extinction so that their populations could recover The National Environmental Policy Act A B C D The Clean Air Act The Clean Water Act The Endangered Species Act

Which is a possible contributor to global warming O A B C D The products released from burning of fossil fuels The products released from photosynthesis The products released from cellular respiration The products released from evaporation

What direct impact do introduced species have on an ecosystem A B D Decrease in the amount of pollutants Prey on or crowd out native species causing a decline in population numbers Increase the carrying capacity of an ecosystem for native species Increase the rate of biomagnification caused by pollutants

Which of the following is NOT considered to be a greenhouse gas O O O A B C D Oxygen Carbon dioxide Water vapor Methane

Which of the following is not directly part of a person s ecological footprint A B Oc C The amount of food and water consumed Transportation and energy needs The amount of children a person contributes to the growing population Amount of waste produced

What is meant by Earth s carrying capacity in relation to human population growth A B C D The population of people currently living on the planet The total amount of people that can consistently be supported by Earth The total amount of people that have existed on Earth to date The total amount of people currently using renewable resources

Which of the following statements about triacylglycerol metabolism is correct View Available Hint s O The glycerol produced is not utilized and is eliminated as waste Hydrolysis of dietary triacylglycerols occurs when they enter the small intestine from the stomach O Stored triacylglycerols will only be used as an energy source when triggered by a hormone level change When other energy sources are available in ample supply fatty acids will be oxidized into acetyl CoA

How is the availability of needed natural resources affected by human activiti

Uzun Bir Ya am i in Genler ok Yash Solucanlar Caenorhabditis elegans t r bu solucan iki haftal k ve art k l me ok yakla ti v cudu kurumu ve zorlukla hareket ediyor C elegans normalde iki ya da hafta ya ar ve o u insan gibi o da ya n belli eder Derisi de i ir hareketleri yava lar ve gen ken oldu u gibi besin bulmak i in enerjiyle ko u turamaz Homer yak ndaki bir mikroskopta 5 haftal k bir kuzeni yat yor Ancak di erinden iki kat ya olmas na ra men bu C e legans bir anaokulu rencisi gibi k p r k p r Bilim insanlan yuvarlak kurtlarda uzun ya am n anahtar n buldular C ele pans gen tutan genieri Bilim insanlan kimyasal maddeler ve beslenme sayesinde baz genleri kapatip baz lannin daha ok al mas n sa ladilar ve ya lanmalar na ra men sa l kl ve g l kalmalann ba ard lar Verilen bilgiye g re 1 Bu y ntem sayesinde gelecekte insanlar sa l kl ve g l kalabilir II Burada solucanlan n hi ya lanmadan daha uzun s re ya amas sa lanm t r III Solucan n ya lanmamas n sa layan genlerin kar lmas ya lan mas n geciktirmi tir kar mlar ndan hangileri do rudur A Yaln z I B Yaln z II C II ve III D I Il ve Ill

Over the last few decades scientists have noticed that lobsters which obtain heat from the environment rather than generating it themselves are moving north at a rate of six kilometers per year What is the best explanation based on these observations O Lobsters are adapting to cooler temperatures O Lobsters are looking for mates in northern regions O Lobsters can only reproduce in regions closer to the poles O Lobsters prefer warmer regions early in their life cycles Question 6 Multiple Choice Worth 3 points 03 02 LC An isolated system is best characterized as a system in which O Energy can freely enter and leave but matter cannot O Matter and energy can freely enter and leave O Matter can freely enter and leave but energy cannot

5 Your lab partner arrived late to class on the day you started your fetal pig dissec tion You ve already selected a male pig for your dissection and you want your partner to choose a female Describe how your partner can recognize and select a female pig from the container Be specific

Cystic fibrosis is a Mendelian recessive allele The most common mutation associated with cystic fibrosis is the D F 508 mutation In the UK it is the most common cystic fibrosis variant accounting for 75 of cases However the worldwide frequency of cystic fibrosis associated mutations can vary greatly The frequency of the D F 508 mutation associated with cystic fibrosis in Romania was only 36 6 of cases Country United Kingdom Romania 9 408 9 996 AF 508 392 2 AF 508 AF 508 200 2 a Demonstrate the frequency of the D F 508 mutation is statistically significantly different between these two countries b Explain what could account for the differences if significant Question 2 5 pts Write the spreadsheet to calculate allele frequencies via the General Model of Selection a Calculate an example of selection against the recessive include plot b Calculate an example of selection favoring the homozygote include plot

Actin bundles give shape and support to flagella microvilli cilia lamellipodia found in intestinal mucosal cells

microvilli cilia lamellipodia Question 2 1 point Listen Which of the following represents the most likely pathway for a protein to be secreted from the cell after it is synthesized Smooth ER 1 Golgi secretory vesicle environment lysosome Golgi environment Rough ER Rough ER Golgi smooth ER 1 1 cytoplasm environment 1

Ribosomes that do not anchor on the surface of the rough endoplasmic reticulum during translation most probably have a signal peptidase error have a defect in ribosomal proteins that allow attachment to the surface are made of 3 subunits are synthesizing cytoplasmic proteins

Using the techniques of genetic engineering you design a protein you want to accumulate within the ER of yeast cells To accomplish this goal you need to do nothing all proteins go through the ER incorporate radioactive amino acids into the protein incorporate the appropriate DNA sequence s to create signal sequences in the mature peptide incorporate appropriate mannose 6 phosphate groups

Each of the following is an endoplasmic reticulum function except addition of carbohydrate to proteins to make glycoproteins Opeptide folding the assembly of multimeric proteins breakdown of material ingested by the cell

Pancreatic acinar cells produce and store hydrolytic enzymes in zymogen granules until hormones signal the cell to release the enzymes in a process known as constitutive secretion transport secretion regulated secretion consistent secretion

are part of the structure of cilia maintain cell structure are involved in intracellular organelle transport are required to maintain axons

is a drug that blocks cell division by stabilizing microtubules as a result it is used in the treatment of Taxol breast cancer Vincristine listeriosis Nocodazole athlete s foot

Dynamic assembly and disassembly of a cytoplasmic microtubule in a cell occurs primarily at its plus end because its minus end is usually anchored to a basal body a mitochondrial outer membrane a microtubule organizing center the plasma membrane

Actin filaments may form each of the following except filament networks central shaft of flagellum contractile bundles branched networks

or Use on Fomites isinfection Sanitization Sterilization Reduces or destroys microbial load of an inanimate item through application of heat or antimicrobial chemicals Reduces microbial load of an inanimate item to safe public health levels through application of heat or antimicrobial chemicals Degerming Completely eliminates all vegetative cells endospores and viruses from an inanimate item For Use on Living Tissue Antisepsis Reduces microbial load on skin or tissue through application of an antimicrobial chemical Reduces microbial load on skin or tissue through gentle to firm scrubbing and the use of mild chemicals Cleaning surfaces like laboratory benches clinical surfaces and bathrooms Commercial dishwashing of eating utensils cleaning public restrooms Preparation of surgical equipment and of needles used for injection Cleaning skin broken due to injury cleaning skin before surgery Handwashing Chlorine bleach phenols e g Lysol glutaraldehyde Detergents containing phosphates e g Finish industrial strength cleaners containing quaternary ammonium compounds Pressurized steam autoclave chemicals radiation Boric acid isopropyl alcohol hydrogen peroxide iodine betadine Soap alcohol swab

List of 20 Unknown Bacterial Possibili 1 Alcaligenes faecalis 2 Bacillus cereus 3 Bacillus subtilis 4 Citrobacter freundii 5 Corynebacterium xerosis 6 Enterobacter aerogenes 7 Enterococcus faecalis 8 Escherichia coli 9 Klebsiella pneumoniae 10 Micrococcus luteus 11 Micrococcus roseus 12 Mycobacterium smegmatis 13 Proteus mirabilis 14 Proteus vulgaris 15 Pseudomonas aeruginosa 16 Pseudomonas alcaligenes 17 Pseudomonas fluorescens 25

3 If a man expresses an X linked recessive trait all of his brothers will also express it a b C d e For the trait his father transmitted the trait to him his father carried the trait all of his sisters will also express it his mother was heterozygous or homozygou

5 Y linked traits are males a b C d expressed known as homozygous traits known to skip generations in males carried only by males and transmitted only to carried only by females but are never

The analysis of a patient blood revealed that it contains 14 0 g hemoglobin Hb per 100 mL of blood and 3 5 x 106 erythrocytes in 1 mm of blood a Find the mass of Hb that is contained in one erythrocyte 1 L 1dm3 b Estimate the average number of Hb molecules that are present in one erythrocyte if we know that the molar mass of Hemoglobin is 70 10 g mol 4 shem c Each molecule of hemoglobin contains 4 atoms of iron What is the mass of iron that is contained in the whole volume of a human blood It should be assumed that the avarage blood volume of an adult person is 5 L 16

1 Diabetes has been found to be inherited in many cases through a recessive allele d Two parents who are non diabetic have a diabetic child Write the genotypes of all three persons 2 In corn there are two alleles for the gene for sugar content High sugar content su is recessive to low sugar content Su Give the phenotypes for each of the following individuals Susu susu SuSu 3 Skin color in a fish is inherited via a single gene with four different alleles How many different genotypes would be possible in this system List them 4 Achondroplasia a form of dwarfism is inherited as a dominant condition Two dwarfs both of whom had one parent of normal height marry and plan to a have child Their first child is born and is a dwarf What is the probability that this child is heterozygous

9 Crosses between long and oval shaped radishes produced 159 long and 156 oval types Crosses between oval and round gave 203 oval and 199 round However crosses between oval and oval gave 121 long 243 oval and 119 round How can you explain these results 10 A man with group A blood marries a woman with group B blood Their child has group O blood What are the genotypes of these individuals What other genotypes and in what frequencies would you expect in offspring from this marriage

6 Male pattern baldness is a recessive sex linked trait on the X chromosome A woman whose father had male pattern baldness marries a man with this trait What is the probability that any son born will have pattern baldness 7 In humans normal skin color A is dominant over albino a A diabetic albino man marries a normal woman whose mother was an albino and whose father was diabetic What are the genotypes of the man and the woman What proportion of their children would be expected to be both non diabetic and have normal color 8 A person with Rh blood has a specific protein in his her blood Persons with Rh blood do not have this particular protein in their blood Rh is dominant to Rh Also normal insulin production dominates abnormal insulin production If two individuals are heterozygous for Rh and normal insulin production what probable phenotypes might thain ohildran ha

5 A pair of dominant alleles influence coat color in cattle wherein homozygotes for one allele have red coats homozygotes for the other allele have white coats and heterozygotes have roan coats that are produced by an intermix of both red and white hairs Suppose that you start with a herd of 20 red cows 40 roan cows 20 white cows one red bull two roan bulls and one white bull How you would manage your herd to achieve the following goals you can choose which bulls will mate with which cows a Maximize the number of roan calves produced Could you achieve 100 b Minimize the number of roan calves produced Could you achieve 0 c Produce only roan and red calves

QUESTION 9 Which one of the following mutations in the primary structure would you expect to cause the most drastic alteration in the functional performance of a protein O Replacement of Val with Ala O Replacement of Glu with Lys O Replacement of Asp with Glu Replacement of Lys with Arg O Replacement of Ser with Thr QUESTION 10

How many grams of Disodium monohydrogen phosphate MW 137 99g mol do I need to prepare a 40mM solution at a final volume of 650mL Don t add units to your answer Keep two decimal digits

To calculate the energy generated by the oxidation of a fatty acid Fatty acids yield more than twice as much energy per gram as carbohydrates The image below shows the B oxidation pathway a series of four reactions that oxidizes fatty acyl SCoA to acetyl SCOA Note that the fatty acid is converted to fatty acyl SCOA energy requiring process before it enters the B oxidation pathway The hydrocarbon tail of the fatty acid is represented by CH atoms and the R group in acyl SCOA Y Part A AEO S Step 4 A carbon carbon bond is broken to yield acetyl SCOA and a chain shortened fatty acid BHE 2 Step 3 The alcohol group is oxidized to a ketone The coenzyme NAD is used H SCOA 4 iza i R CH CH C CH C SCOA R CH CH R CH CH C SCOA CH3 C SCOA Calculate the number of molecules of acetyl SCoA derived from a saturated fatty acid with 22 carbon atoms Express your answer as an integer View Available Hint s molecule s H H R CH CH CH CH C SCOA 4 NADH H NAD 11 Further oxidation repetition of Steps 1 4 1 Energy is generated from the electrons of FADH and NADH that enter the electron transport chain and from the passage of acetyl SCOA through the citric acid cycle FAD H R CH CH OH R CH CH CH CH C SCOA 2 41 0 FADH Step 1 A double bond is introduced by enzyme catalyzed removal of two hydrogens from carbons 2 and 3 The coenzyme FAD is needed for this step C SCOA H Step 2 Water adds to the double bond to yield an alcohol

2 How does a geneticist use pedigrees to create genetic crosses to trace the inheritance of traits over generations of families to prove that sex linked traits are caused by codominant allel Oto replicate identical strings of DNA

1 Primers and Base pairing 3 points Primers are usually approximately 20 nucleotides long For this activity we will use a 5 base pair primer Using this primer 5 GATAC 3 Show where the primer binds to your template DNA below Indicate the primer by using bold text Then act as the polymerase and fill in the rest of the new strand of DNA DNA polymerase can only add to the 3 M end of the new DNA strand New DNA strand Template DNA 3 3 TAGCTATGCGGACCTCATGCATTAGAGTA G 5 5

e an allele passed from parent to child on a sex chromosome O a geneticist who studies the inheritance of traits in humans A chart that tracks which members of a family have a particular trait OO a picture of all of the chromosomes in a cell

How many grams of Potassium acetate MW 98 14g mol do I need to prepare a 225mM solution at a final volume of 250mL Don t add units to your answer Keep two decimal digits A

How many microliters of a Tween 20 solution 100 v v do I need to prepare a 0 09 solution in a final volume of 165mL Don t add units to your answer Keep one decimal digit

How many microliters of a 0 6M DTT solution do I need to prepare a 0 4mM solution in a final volume of 80mL Don t add units to your answer Keep one decimal digit A

How many microliters of a 0 75M DTT solution do I need to prepare a 0 5mM solution in a final volume of 250mL Don t add units to your answer Keep one decimal digit

How many grams of HEPES MW 238 3g mol do I need to prepare a 30mM solution at a final volume of 110mL Don t add units to your answer Keep two decimal digits

How many grams of Sodium chloride MW 58 48g mol do I need to prepare a 230mM solution at a final volume of 350mL Don t add units to your answer Keep two decimal digits

Which glial cells makes cerebrospinal fluid Omicroglia ependymal cells oligodendrocytes

O centers of gray matter deep to the cortex tracts of white matter connecting different cortical centers collections of synapses along afferent sensory pathways collections of cell bodies in the brain stem Question 24 1 point Which brain area contains nuclei responsible for heart rate breathing rate and alertness the cerebellum the basal nuclei the reticular formation

the epidural space the subdural space the subarachnoid space Question 26 1 point What is found inside the dural sinuses cerebrospinal fluid Olymph air blood

A neuromuscular junction will be considered part of the nervous system Ovisceral sensory somatic motor O visceral motor Osomatic sensory division of the peripheral Question 20 1 point Which channels are important to propagate the action potential down the length of a neuron myelinated or non myelinated voltage gated sodium channels mechanically gated sodium channels ligand gated sodium channels

What type of sensory stimulus provides the afferent arm of the patellar knee Jerk stretch reflex vibration sense from the Pacinian corpuscles linear acceleration from maculae of the utricle and saccule equilibrium sense from proprioceptors in joints stretch of muscle spindles Question 28 1 point Receptors that transmit painful stimuli are also known as O mechanoreceptor Ophotoreceptor nociceptors

dopaminergic cholinergic serotonergic adrenergic Question 30 1 point Which part of the retina gives you your best vision the choroid the ora serrata the fovea centralis the optic disc

What happens to the neuron s membr depolarization hyperpolarization no change in membrane potential Orepolarization Question 8 1 point Most neurons are this type of neuron Opseudounipolar multipolar