Biology Questions

The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.
Listen The lagging strand is synthesized using the DNA strand as a template 5 3
Biology
Principles of Inheritance & Variation (Genetics)
Listen The lagging strand is synthesized using the DNA strand as a template 5 3
3 5 1 Question 10 1 point 4 Listen During base excision repair Endonuclease breaks bond Oionic phosphobiester hydrogen
Biology
Biomolecules
3 5 1 Question 10 1 point 4 Listen During base excision repair Endonuclease breaks bond Oionic phosphobiester hydrogen
Errors in RNA synthesis are corrected by DNA polymerase II corrected by DNA polymerase III are more critical compared to errors in DNA replication corrected by RNA backtracking
Biology
Principles of Inheritance & Variation (Genetics)
Errors in RNA synthesis are corrected by DNA polymerase II corrected by DNA polymerase III are more critical compared to errors in DNA replication corrected by RNA backtracking
During base excision repair Endonuclease breaks ionic phosphobiester Ohydrogen van der waal interactions bond
Biology
Cell: The Unit of Life
During base excision repair Endonuclease breaks ionic phosphobiester Ohydrogen van der waal interactions bond
The lagging strand is synthesized using the 5 3 3 5 1111 DNA strand as a template
Biology
Molecular Basis of Inheritance
The lagging strand is synthesized using the 5 3 3 5 1111 DNA strand as a template
How many primers are required for DNA polymerase to build the leading strand 3 5 2
Biology
Cell: The Unit of Life
How many primers are required for DNA polymerase to build the leading strand 3 5 2
Which of the following is NOT true regarding DNA polymerase It requires an RNA polymerase to initiate the synthesis of the polynucleotide It utilizes dNTPs to build the new strand It has proofreading activity It adds a new nucleotide to the 5 end of the existing chain
Biology
Principles of Inheritance & Variation (Genetics)
Which of the following is NOT true regarding DNA polymerase It requires an RNA polymerase to initiate the synthesis of the polynucleotide It utilizes dNTPs to build the new strand It has proofreading activity It adds a new nucleotide to the 5 end of the existing chain
The alpha subunit of RNA polymerase binds 100 the 10 sequence O the up stream element O the 35 sequence the pincer
Biology
Principles of Inheritance & Variation (Genetics)
The alpha subunit of RNA polymerase binds 100 the 10 sequence O the up stream element O the 35 sequence the pincer
O part of the structure of lysosomes the protein machinery assembled for DNA replication the protein machinery assembled for transciption required for assembly of ribosomes on mRNA
Biology
Cell: The Unit of Life
O part of the structure of lysosomes the protein machinery assembled for DNA replication the protein machinery assembled for transciption required for assembly of ribosomes on mRNA
Termination of RNA transcription occurs when RNA polyemrase forms a hairpin with a short G C rich sequence is cleaved by an endonuclease reaches a stop codon is degraded by a protease 121
Biology
Principles of Inheritance & Variation (Genetics)
Termination of RNA transcription occurs when RNA polyemrase forms a hairpin with a short G C rich sequence is cleaved by an endonuclease reaches a stop codon is degraded by a protease 121
estion 38 What is common to both photosystems I and II O Both involve the splitting of water to donate an electron to the reaction center O Both involve the generation of oxygen O Both lose an electron to a primary electron acceptor that passes the electron down an electron transport chain leading to the generation of ATP O Both contain a reaction center composed of chlorophyll a O Both are found in the stroma Eyecanda S
Biology
Anatomy of Flowering Plants
estion 38 What is common to both photosystems I and II O Both involve the splitting of water to donate an electron to the reaction center O Both involve the generation of oxygen O Both lose an electron to a primary electron acceptor that passes the electron down an electron transport chain leading to the generation of ATP O Both contain a reaction center composed of chlorophyll a O Both are found in the stroma Eyecanda S
The light independent reactions of photosynthesis are those that O convert glucose into energy convert chlorophylls into light energy convert water into hydrogen and oxygen convert CO2 into reduced molecules sugars occur only at night
Biology
Plant Physiology - Photosynthesis
The light independent reactions of photosynthesis are those that O convert glucose into energy convert chlorophylls into light energy convert water into hydrogen and oxygen convert CO2 into reduced molecules sugars occur only at night
Question 40 NADPH is made by O chemiosmosis O glycolysis the Krebs cycle O the Calvin cycle the passing of electrons from photosystem I to an electron transport chain
Biology
Plant Physiology - Respiration
Question 40 NADPH is made by O chemiosmosis O glycolysis the Krebs cycle O the Calvin cycle the passing of electrons from photosystem I to an electron transport chain
Question 4 Based on the graph what are the optimal temperatures for the human enzyme and hotsprings prokaryote enzyme Rate of Reaction OO Copyright The McGraw Hill Companies Inc Permission required for reproduction or display Human enzyme 30 40 50 Hotsprings prokaryote 60 Temperature of Reaction C 70 80 O The optimal temperature for the human enzyme is 30 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 60 degrees C The optimal temperature for the human enzyme is 40 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 72 degrees C O The optimal temperature for the human enzyme is 46 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 79 degrees C O The optimal temperature for the human enzyme is 35 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 65 degrees C 2 poim
Biology
Biomolecules
Question 4 Based on the graph what are the optimal temperatures for the human enzyme and hotsprings prokaryote enzyme Rate of Reaction OO Copyright The McGraw Hill Companies Inc Permission required for reproduction or display Human enzyme 30 40 50 Hotsprings prokaryote 60 Temperature of Reaction C 70 80 O The optimal temperature for the human enzyme is 30 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 60 degrees C The optimal temperature for the human enzyme is 40 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 72 degrees C O The optimal temperature for the human enzyme is 46 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 79 degrees C O The optimal temperature for the human enzyme is 35 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 65 degrees C 2 poim
at is biomagnification
Biology
Biotechnology & its Applications
at is biomagnification
Climbing a wall of ice requires careful interaction among all parts of the body You probably know that muscles and the brain work together to coordinate the climber s movement The heart and lungs also have to work together to help provide energy for the climb Yet every human body starts as a single cell a fertilized zygote How does a single cell give rise to all the different types of cells tissues and organs in the human body Further how do such different parts coordinate their activities to keep the body functioning
Biology
Evolution
Climbing a wall of ice requires careful interaction among all parts of the body You probably know that muscles and the brain work together to coordinate the climber s movement The heart and lungs also have to work together to help provide energy for the climb Yet every human body starts as a single cell a fertilized zygote How does a single cell give rise to all the different types of cells tissues and organs in the human body Further how do such different parts coordinate their activities to keep the body functioning
What does an indicator species tell us about the health of an ecosystem
Biology
The Living World
What does an indicator species tell us about the health of an ecosystem
Describe three ways people can decrease their ecological footprint to help manage Earth s resources
Biology
Biomolecules
Describe three ways people can decrease their ecological footprint to help manage Earth s resources
How do human organ systems interact to provide for the needs of the human organism
Biology
Human Physiology - General
How do human organ systems interact to provide for the needs of the human organism
Are humans likely affected by biomagnification If so which foods might be dangerous
Biology
The Living World
Are humans likely affected by biomagnification If so which foods might be dangerous
Identify pollutants that contaminate water ecosystem
Biology
Biological Classification
Identify pollutants that contaminate water ecosystem
How might global warming affect seasonal temperature changes
Biology
Ecology - Environmental Issues
How might global warming affect seasonal temperature changes
How are particulates harmful to the biosphere
Biology
Ecology - Environmental Issues
How are particulates harmful to the biosphere
What is global warming
Biology
The Living World
What is global warming
xplain how an increase in greenhouse gases contribute to an increase in average global temperature
Biology
Ecology - Environmental Issues
xplain how an increase in greenhouse gases contribute to an increase in average global temperature
What is the greenhouse effect and how does it keep Earth warm
Biology
The Living World
What is the greenhouse effect and how does it keep Earth warm
Identify 5 pollutants that accumulate in the ai
Biology
The Living World
Identify 5 pollutants that accumulate in the ai
ow does a person s ecological footprint relate to the amount of resources they consume
Biology
Ecology - Ecosystems
ow does a person s ecological footprint relate to the amount of resources they consume
What is the difference between renewable and nonrenewable resources
Biology
Biomolecules
What is the difference between renewable and nonrenewable resources
List 2 examples of nonrenewable resources you use regularly
Biology
The Living World
List 2 examples of nonrenewable resources you use regularly
List 2 examples of renewable resources you use regularly
Biology
Ecology - Environmental Issues
List 2 examples of renewable resources you use regularly
List factors that affect the size of an ecological footprint
Biology
Ecology - Ecosystems
List factors that affect the size of an ecological footprint
What is an ecological footprint and how is it related to an area of land
Biology
The Living World
What is an ecological footprint and how is it related to an area of land
Give an example of how technology has influenced human population growth
Biology
Ecology - Organisms & Population
Give an example of how technology has influenced human population growth
Summarize what is meant by Earth s carrying capacity
Biology
Ecology - Ecosystems
Summarize what is meant by Earth s carrying capacity
d What is the probability 50 20 The color of flowers in snap dragons shows incomplete dominance Red CC and white CC are homozygous and pink C Cw is heterozygous If a red snap dragon is crossed with a white snap dragon what is the phenotype of the offspring Pick What are the possible genotypes of the offspring B A pink flower is crossed with a red flower Make a Punnett Square to determine the possible offspring e f h i What is the probability of the offspring being red What is the probability of the offspring being white What is the probability of the offspring being pink The genotype for normal blood cells is N shaped blood cells
Biology
Human Physiology - General
d What is the probability 50 20 The color of flowers in snap dragons shows incomplete dominance Red CC and white CC are homozygous and pink C Cw is heterozygous If a red snap dragon is crossed with a white snap dragon what is the phenotype of the offspring Pick What are the possible genotypes of the offspring B A pink flower is crossed with a red flower Make a Punnett Square to determine the possible offspring e f h i What is the probability of the offspring being red What is the probability of the offspring being white What is the probability of the offspring being pink The genotype for normal blood cells is N shaped blood cells
Mark all substances on this list that can normally pass through the blood brain barrier small lipid soluble nonpolar drugs gases like oxygen and carbon dioxide glucose because there s a transporter plasma proteins red blood cells bacteria
Biology
Biomolecules
Mark all substances on this list that can normally pass through the blood brain barrier small lipid soluble nonpolar drugs gases like oxygen and carbon dioxide glucose because there s a transporter plasma proteins red blood cells bacteria
Which one of the following functions of CSF allows CSF to protect the brain from its own weight OCSF helps regulate electrolyte levels within the brain CSF allows the brain to float OCSF removes wastes CSF maintains a constant temperature within the cranial cavity
Biology
Human Physiology - Neural Control & Coordination
Which one of the following functions of CSF allows CSF to protect the brain from its own weight OCSF helps regulate electrolyte levels within the brain CSF allows the brain to float OCSF removes wastes CSF maintains a constant temperature within the cranial cavity
Ependymal cells are a type of neuroglia One of the functions of ependymal cells is to produce CSF from fluid that leaks out of the choroid plexus Where does CSF production occur in the ventricles in the epidural space O in the arachnoid granulations the dural sinuses O
Biology
Human Physiology - Neural Control & Coordination
Ependymal cells are a type of neuroglia One of the functions of ependymal cells is to produce CSF from fluid that leaks out of the choroid plexus Where does CSF production occur in the ventricles in the epidural space O in the arachnoid granulations the dural sinuses O
Name the two structures of the brain that are directly concerned with maintaining your body s homeostasis the hypothalamus the reticular formation the thalamus the cerebellum
Biology
Human Physiology - Neural Control & Coordination
Name the two structures of the brain that are directly concerned with maintaining your body s homeostasis the hypothalamus the reticular formation the thalamus the cerebellum
If you cut the brain in the midline between the two halves of the thalamus what structure do you cut through between those two halves the corpus callosum the hypothalamus the third ventricle the fourth ventricle
Biology
Human Physiology - Neural Control & Coordination
If you cut the brain in the midline between the two halves of the thalamus what structure do you cut through between those two halves the corpus callosum the hypothalamus the third ventricle the fourth ventricle
look at the inferior surface of the brain anterior to the optic chiasm pull apart the frontal parietal and temporal lobes make a midline incision through the corpus callosum follow the brainstem up from the sihinal cord
Biology
Human Physiology - Neural Control & Coordination
look at the inferior surface of the brain anterior to the optic chiasm pull apart the frontal parietal and temporal lobes make a midline incision through the corpus callosum follow the brainstem up from the sihinal cord
If you were to pull the cerebral cortex into the shape of a blanket rather than all of the ups and downs of gyri and sulci how big would it be 1 square foot 2 5 square feet 5 square feet 10 square feet
Biology
Human Physiology - Neural Control & Coordination
If you were to pull the cerebral cortex into the shape of a blanket rather than all of the ups and downs of gyri and sulci how big would it be 1 square foot 2 5 square feet 5 square feet 10 square feet
5 Met Pro GG Translation Translation Ser AUGCCUAGUCGGUAAAAA AA 3 Arg Met Phase AUGCCUAGUCGGUAAAAAAAAA 3
Biology
Principles of Inheritance & Variation (Genetics)
5 Met Pro GG Translation Translation Ser AUGCCUAGUCGGUAAAAA AA 3 Arg Met Phase AUGCCUAGUCGGUAAAAAAAAA 3
36 If the temperature of a rock unit is elevated significantly the rock is more like a Deform plastically than elastically b Undergo brittle failure than plastic deformation C Deform elastically rather than undergo brittle deformation d Deform elastically than plastically 37 The amount of earthquake shaking and ground motion is a result of The magnitude of the earthquake event a b The depth of the focus C The geology of the soil and rock d All of the above contribute to the shaking 38 The type of fault most commonly found in divergent plate boundaries a Normal or gravity faults Reverse faults b C Strike slip faults d Transform or thrust faults 39 If an earthquake occurs the first waves to arrive at a seismographic station a P waves b S waves c Rayleigh waves d Love waves 40 Transverse S waves are only generated through a Liquids b Solids C 1 Any substance d Gas 41 A Love wave is C a A transverse surface wave with a swaying side to side motion b A longitudinal surface wave with an up and down motion The primary wave d The first wave felt as it is generated faster than a Rayleigh wave
Biology
Human Physiology - Breathing & Exchange of Gases
36 If the temperature of a rock unit is elevated significantly the rock is more like a Deform plastically than elastically b Undergo brittle failure than plastic deformation C Deform elastically rather than undergo brittle deformation d Deform elastically than plastically 37 The amount of earthquake shaking and ground motion is a result of The magnitude of the earthquake event a b The depth of the focus C The geology of the soil and rock d All of the above contribute to the shaking 38 The type of fault most commonly found in divergent plate boundaries a Normal or gravity faults Reverse faults b C Strike slip faults d Transform or thrust faults 39 If an earthquake occurs the first waves to arrive at a seismographic station a P waves b S waves c Rayleigh waves d Love waves 40 Transverse S waves are only generated through a Liquids b Solids C 1 Any substance d Gas 41 A Love wave is C a A transverse surface wave with a swaying side to side motion b A longitudinal surface wave with an up and down motion The primary wave d The first wave felt as it is generated faster than a Rayleigh wave
24 Volcanoes have a positive service function by a Replenishing soil with nutrients b Lava flows creating ghost forests for us to marvel Allowing fluorine in water that is ultimately good for our teeth Volcanoes serve no positive function just ask the people at Pompeii d 25 A lahar can best be described as Flow of gas and hot ash Hot lava flow moving very fast A flow of hot mud with the consistency of wet cement d A rain of volcanic ash whose weight can cause roofs to collapse 26 Shield cones are most likely to form from Effusive eruptions from a central vent b Explosive eruptions from a central vent C Culminating pyroclastic eruptions d Lahars 27 Calderas form when A fissure C a b C erupt happens b Mafic magmas are heavy and sink Magma chamber empties and volcanic edifice collapses Lava flows are greater than pyroclastic flows during an eruptive episode a a C C d a 28 The distance inland that a tsunami travels is known as A local tsunami event b A distant tsunami event a Tsunami run up d Hydraulic displacement 29 A normal fault occurs as a result of Tensional stress the hanging wall moves down relative to the foot wall b Tensional stress the hanging wall move relative to the footwall c Compressive stress the hanging wall moves down relative to the footwal d Compressive stress the hanging wall move up relative to the footwall
Biology
Structural Organization in Animals
24 Volcanoes have a positive service function by a Replenishing soil with nutrients b Lava flows creating ghost forests for us to marvel Allowing fluorine in water that is ultimately good for our teeth Volcanoes serve no positive function just ask the people at Pompeii d 25 A lahar can best be described as Flow of gas and hot ash Hot lava flow moving very fast A flow of hot mud with the consistency of wet cement d A rain of volcanic ash whose weight can cause roofs to collapse 26 Shield cones are most likely to form from Effusive eruptions from a central vent b Explosive eruptions from a central vent C Culminating pyroclastic eruptions d Lahars 27 Calderas form when A fissure C a b C erupt happens b Mafic magmas are heavy and sink Magma chamber empties and volcanic edifice collapses Lava flows are greater than pyroclastic flows during an eruptive episode a a C C d a 28 The distance inland that a tsunami travels is known as A local tsunami event b A distant tsunami event a Tsunami run up d Hydraulic displacement 29 A normal fault occurs as a result of Tensional stress the hanging wall moves down relative to the foot wall b Tensional stress the hanging wall move relative to the footwall c Compressive stress the hanging wall moves down relative to the footwal d Compressive stress the hanging wall move up relative to the footwall
a 18 The portion of the Earth C a b Lithosphere c Asthenosphere d Both a b 19 Tectonic plates are actively separating in all of the following EXCEPT a Rift zones b Sea floor spreading areas c Subducting plate boundaries d The mid ocean ridges 20 The force that causes volcanoes to explode violently is Hot convection currents in the asthenosphere that pushes magma upward a b The large amount of iron found within mafic volcanoes c Expanding pressure from volcanic gases called volatiles d Low viscosity magmas 21 The more silica in the magma the more likely a A powerful eruption will occur b The lava erupted will flow easily causing hazards The more volatile gasses can escape readily d The lava will have low viscosity 22 A volcano can spew several kinds of gas into the air but most of the gas is Water vapor and carbon dioxide Crust and entrained mantle b Nitrogen and Sulphur dioxide c Sulphur dioxide and chlorine d Nitrogen that why it s the most common gas 71 in atmosphere 23 As seen in the video when the amount of Sulphur dioxide emissions are measured COSPEC suddenly drops at an active volcano this indicates that a The vent is blocked and pressure is building b The magma has not been contaminated c Sulphur dioxide has been replaced by water vapor d We can breathe easier the volcano is unlikely to erupt
Biology
Ecology - Environmental Issues
a 18 The portion of the Earth C a b Lithosphere c Asthenosphere d Both a b 19 Tectonic plates are actively separating in all of the following EXCEPT a Rift zones b Sea floor spreading areas c Subducting plate boundaries d The mid ocean ridges 20 The force that causes volcanoes to explode violently is Hot convection currents in the asthenosphere that pushes magma upward a b The large amount of iron found within mafic volcanoes c Expanding pressure from volcanic gases called volatiles d Low viscosity magmas 21 The more silica in the magma the more likely a A powerful eruption will occur b The lava erupted will flow easily causing hazards The more volatile gasses can escape readily d The lava will have low viscosity 22 A volcano can spew several kinds of gas into the air but most of the gas is Water vapor and carbon dioxide Crust and entrained mantle b Nitrogen and Sulphur dioxide c Sulphur dioxide and chlorine d Nitrogen that why it s the most common gas 71 in atmosphere 23 As seen in the video when the amount of Sulphur dioxide emissions are measured COSPEC suddenly drops at an active volcano this indicates that a The vent is blocked and pressure is building b The magma has not been contaminated c Sulphur dioxide has been replaced by water vapor d We can breathe easier the volcano is unlikely to erupt
48 A lateral blast from a volcano Is called a Pelean eruption a b Common with plinian eruptions such as Mt St Helens Can generate pyroclastic flows d All of the above 49 When a rhyolite dome forms in a volcanic crater this indicates Silica rich magma with high viscosity is blocking the vent b The volcano has degassed become less likely to erupt c A mafic magma will erupt next d All of the above 50 The viscosity of a lava is based on a Temperature and silica content b The amount of ash fall from a volcano Size of pyroclastic material d None of the above is a measure of viscosity33396
Biology
The Living World
48 A lateral blast from a volcano Is called a Pelean eruption a b Common with plinian eruptions such as Mt St Helens Can generate pyroclastic flows d All of the above 49 When a rhyolite dome forms in a volcanic crater this indicates Silica rich magma with high viscosity is blocking the vent b The volcano has degassed become less likely to erupt c A mafic magma will erupt next d All of the above 50 The viscosity of a lava is based on a Temperature and silica content b The amount of ash fall from a volcano Size of pyroclastic material d None of the above is a measure of viscosity33396
b The frequency of the wave The wavelength of the wave d Amplitude of the largest peal 43 Surface rocks at low temperature are most likely to a Experience brittle deformation b Experience plastic deformation C Have a high yield point d Be very ductile creating folds 44 With destructive interference the seismic waves C a Causes wave amplification linked to greater destructiveness Creates the initial trough that arrive before a tsunami event Causes landslides to occur on unstable slopes d Cancel each other out creating a flat line b C C 45 Flood basalts form from a Only powerful eruptions with a lot of lava flows b Fissure eruptions Stratocone or composite volcanoes d Cinder cones volcanoes 46 Seismic waves move fastest through a Hard consolidated bedrock b Soft alluvium soils c Liquids d Attenuation 47 Triangulation is used to a Find the path of greatest rupture b Show the amount of attenuation Measure the amount of fault rupture d The location of the epicenter
Biology
The Living World
b The frequency of the wave The wavelength of the wave d Amplitude of the largest peal 43 Surface rocks at low temperature are most likely to a Experience brittle deformation b Experience plastic deformation C Have a high yield point d Be very ductile creating folds 44 With destructive interference the seismic waves C a Causes wave amplification linked to greater destructiveness Creates the initial trough that arrive before a tsunami event Causes landslides to occur on unstable slopes d Cancel each other out creating a flat line b C C 45 Flood basalts form from a Only powerful eruptions with a lot of lava flows b Fissure eruptions Stratocone or composite volcanoes d Cinder cones volcanoes 46 Seismic waves move fastest through a Hard consolidated bedrock b Soft alluvium soils c Liquids d Attenuation 47 Triangulation is used to a Find the path of greatest rupture b Show the amount of attenuation Measure the amount of fault rupture d The location of the epicenter
c Compressive stress the hanging wall moves down relative d Compressive stress the hanging wall moves up relative to the footwall 31 Elastic deformation may occur when rocks are subject to a Compressive stress b Tensional stress C Shearing stress d Any type of stress 32 Rocks in which elastic deformation occurs Return to their original shape when stress is released Remain in their deformed shape when stress is released Become fractured but retain their original shape d Show no response to stress 33 Rocks in which plastic deformation occurs a b a Tensional stress the b Tensional stress the hanging wall moves up a C b Return to their original shape when stress is released Remain in their deformed shape when stress is released Become fractured but retain their original shape d Show no response to stress 34 Stress is the force applied to rock per unit area strain is a Only ductile b A change in shape or volume c Only brittle resulting in a fracture d Mitigated by an increase in stress 5 Strain is deformation resulting in a Stress b Slip C Magnitude d Cohesion
Biology
The Living World
c Compressive stress the hanging wall moves down relative d Compressive stress the hanging wall moves up relative to the footwall 31 Elastic deformation may occur when rocks are subject to a Compressive stress b Tensional stress C Shearing stress d Any type of stress 32 Rocks in which elastic deformation occurs Return to their original shape when stress is released Remain in their deformed shape when stress is released Become fractured but retain their original shape d Show no response to stress 33 Rocks in which plastic deformation occurs a b a Tensional stress the b Tensional stress the hanging wall moves up a C b Return to their original shape when stress is released Remain in their deformed shape when stress is released Become fractured but retain their original shape d Show no response to stress 34 Stress is the force applied to rock per unit area strain is a Only ductile b A change in shape or volume c Only brittle resulting in a fracture d Mitigated by an increase in stress 5 Strain is deformation resulting in a Stress b Slip C Magnitude d Cohesion