Biology Questions

assay show silencer sequence in the regulator region of the BRCA2 gene in three different types of breast cancer cells MDA MB 231 breast cancer cells type 1 and BT549 cells breast epithelial ductal cancer cells type 2 and MDA MB 468 cells breast cancer cells type 3 PCR was performed with primers amplifying the silencer sequence and run on a gel and stained with ethidium bromide Silencing Complex Silencer SLUG Deacetylated Histones CBP 1 Promoter HDAC 1 Transcription Silencing Input SLUG 1 Based on the data which type of cancer cell has the repressor SLUG bound to the BRCA2 gene CIBP 1 2 Based on the data which type of cancer cell has the other members of the repressor complex bound to the BRCA2 gene HDAC 1 3 Based on the data which type of cancer cell in likely expressing the BRCA2 gene and which is not Why can you only predict a likely hood and not definitive expression Input 4 The input lanes are the results of the PCR using all of the sonicated DNA i e not precipitated with an antibody at all like shown in the schematic Step2 as the template in the PCR step of ChIP What is the role or purpose of the input data in this assay 5 Based on your understanding of cancer biology predeict what would the data look like sketch it if this assay was done on a normal breast epithelial cell Normal Breast epithelial cells 6 Based on the data is the BRACA gene an oncogene or TSG Explain

Which effect is associated with overnutrition O decreased risk of obesity decreased risk of mineral poisoning increased cognitive function Thy increased risk of vitamin poisoning

Listen The lagging strand is synthesized using the DNA strand as a template 5 3

3 5 1 Question 10 1 point 4 Listen During base excision repair Endonuclease breaks bond Oionic phosphobiester hydrogen

Errors in RNA synthesis are corrected by DNA polymerase II corrected by DNA polymerase III are more critical compared to errors in DNA replication corrected by RNA backtracking

During base excision repair Endonuclease breaks ionic phosphobiester Ohydrogen van der waal interactions bond

The lagging strand is synthesized using the 5 3 3 5 1111 DNA strand as a template

How many primers are required for DNA polymerase to build the leading strand 3 5 2

Which of the following is NOT true regarding DNA polymerase It requires an RNA polymerase to initiate the synthesis of the polynucleotide It utilizes dNTPs to build the new strand It has proofreading activity It adds a new nucleotide to the 5 end of the existing chain

The alpha subunit of RNA polymerase binds 100 the 10 sequence O the up stream element O the 35 sequence the pincer

O part of the structure of lysosomes the protein machinery assembled for DNA replication the protein machinery assembled for transciption required for assembly of ribosomes on mRNA

Termination of RNA transcription occurs when RNA polyemrase forms a hairpin with a short G C rich sequence is cleaved by an endonuclease reaches a stop codon is degraded by a protease 121

estion 38 What is common to both photosystems I and II O Both involve the splitting of water to donate an electron to the reaction center O Both involve the generation of oxygen O Both lose an electron to a primary electron acceptor that passes the electron down an electron transport chain leading to the generation of ATP O Both contain a reaction center composed of chlorophyll a O Both are found in the stroma Eyecanda S

The light independent reactions of photosynthesis are those that O convert glucose into energy convert chlorophylls into light energy convert water into hydrogen and oxygen convert CO2 into reduced molecules sugars occur only at night

Question 40 NADPH is made by O chemiosmosis O glycolysis the Krebs cycle O the Calvin cycle the passing of electrons from photosystem I to an electron transport chain

Question 4 Based on the graph what are the optimal temperatures for the human enzyme and hotsprings prokaryote enzyme Rate of Reaction OO Copyright The McGraw Hill Companies Inc Permission required for reproduction or display Human enzyme 30 40 50 Hotsprings prokaryote 60 Temperature of Reaction C 70 80 O The optimal temperature for the human enzyme is 30 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 60 degrees C The optimal temperature for the human enzyme is 40 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 72 degrees C O The optimal temperature for the human enzyme is 46 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 79 degrees C O The optimal temperature for the human enzyme is 35 degrees C The optimal temperature for the hotsprings prokaryote enzyme is 65 degrees C 2 poim

at is biomagnification

Climbing a wall of ice requires careful interaction among all parts of the body You probably know that muscles and the brain work together to coordinate the climber s movement The heart and lungs also have to work together to help provide energy for the climb Yet every human body starts as a single cell a fertilized zygote How does a single cell give rise to all the different types of cells tissues and organs in the human body Further how do such different parts coordinate their activities to keep the body functioning

What does an indicator species tell us about the health of an ecosystem

Describe three ways people can decrease their ecological footprint to help manage Earth s resources

How do human organ systems interact to provide for the needs of the human organism

Are humans likely affected by biomagnification If so which foods might be dangerous

Identify pollutants that contaminate water ecosystem

How might global warming affect seasonal temperature changes

How are particulates harmful to the biosphere

What is global warming

xplain how an increase in greenhouse gases contribute to an increase in average global temperature

What is the greenhouse effect and how does it keep Earth warm

Identify 5 pollutants that accumulate in the ai

ow does a person s ecological footprint relate to the amount of resources they consume

What is the difference between renewable and nonrenewable resources

List 2 examples of nonrenewable resources you use regularly

List 2 examples of renewable resources you use regularly

List factors that affect the size of an ecological footprint

What is an ecological footprint and how is it related to an area of land

Give an example of how technology has influenced human population growth

Summarize what is meant by Earth s carrying capacity

d What is the probability 50 20 The color of flowers in snap dragons shows incomplete dominance Red CC and white CC are homozygous and pink C Cw is heterozygous If a red snap dragon is crossed with a white snap dragon what is the phenotype of the offspring Pick What are the possible genotypes of the offspring B A pink flower is crossed with a red flower Make a Punnett Square to determine the possible offspring e f h i What is the probability of the offspring being red What is the probability of the offspring being white What is the probability of the offspring being pink The genotype for normal blood cells is N shaped blood cells

Mark all substances on this list that can normally pass through the blood brain barrier small lipid soluble nonpolar drugs gases like oxygen and carbon dioxide glucose because there s a transporter plasma proteins red blood cells bacteria

Which one of the following functions of CSF allows CSF to protect the brain from its own weight OCSF helps regulate electrolyte levels within the brain CSF allows the brain to float OCSF removes wastes CSF maintains a constant temperature within the cranial cavity

Ependymal cells are a type of neuroglia One of the functions of ependymal cells is to produce CSF from fluid that leaks out of the choroid plexus Where does CSF production occur in the ventricles in the epidural space O in the arachnoid granulations the dural sinuses O

Name the two structures of the brain that are directly concerned with maintaining your body s homeostasis the hypothalamus the reticular formation the thalamus the cerebellum

If you cut the brain in the midline between the two halves of the thalamus what structure do you cut through between those two halves the corpus callosum the hypothalamus the third ventricle the fourth ventricle

look at the inferior surface of the brain anterior to the optic chiasm pull apart the frontal parietal and temporal lobes make a midline incision through the corpus callosum follow the brainstem up from the sihinal cord

If you were to pull the cerebral cortex into the shape of a blanket rather than all of the ups and downs of gyri and sulci how big would it be 1 square foot 2 5 square feet 5 square feet 10 square feet

5 Met Pro GG Translation Translation Ser AUGCCUAGUCGGUAAAAA AA 3 Arg Met Phase AUGCCUAGUCGGUAAAAAAAAA 3

36 If the temperature of a rock unit is elevated significantly the rock is more like a Deform plastically than elastically b Undergo brittle failure than plastic deformation C Deform elastically rather than undergo brittle deformation d Deform elastically than plastically 37 The amount of earthquake shaking and ground motion is a result of The magnitude of the earthquake event a b The depth of the focus C The geology of the soil and rock d All of the above contribute to the shaking 38 The type of fault most commonly found in divergent plate boundaries a Normal or gravity faults Reverse faults b C Strike slip faults d Transform or thrust faults 39 If an earthquake occurs the first waves to arrive at a seismographic station a P waves b S waves c Rayleigh waves d Love waves 40 Transverse S waves are only generated through a Liquids b Solids C 1 Any substance d Gas 41 A Love wave is C a A transverse surface wave with a swaying side to side motion b A longitudinal surface wave with an up and down motion The primary wave d The first wave felt as it is generated faster than a Rayleigh wave

24 Volcanoes have a positive service function by a Replenishing soil with nutrients b Lava flows creating ghost forests for us to marvel Allowing fluorine in water that is ultimately good for our teeth Volcanoes serve no positive function just ask the people at Pompeii d 25 A lahar can best be described as Flow of gas and hot ash Hot lava flow moving very fast A flow of hot mud with the consistency of wet cement d A rain of volcanic ash whose weight can cause roofs to collapse 26 Shield cones are most likely to form from Effusive eruptions from a central vent b Explosive eruptions from a central vent C Culminating pyroclastic eruptions d Lahars 27 Calderas form when A fissure C a b C erupt happens b Mafic magmas are heavy and sink Magma chamber empties and volcanic edifice collapses Lava flows are greater than pyroclastic flows during an eruptive episode a a C C d a 28 The distance inland that a tsunami travels is known as A local tsunami event b A distant tsunami event a Tsunami run up d Hydraulic displacement 29 A normal fault occurs as a result of Tensional stress the hanging wall moves down relative to the foot wall b Tensional stress the hanging wall move relative to the footwall c Compressive stress the hanging wall moves down relative to the footwal d Compressive stress the hanging wall move up relative to the footwall

a 18 The portion of the Earth C a b Lithosphere c Asthenosphere d Both a b 19 Tectonic plates are actively separating in all of the following EXCEPT a Rift zones b Sea floor spreading areas c Subducting plate boundaries d The mid ocean ridges 20 The force that causes volcanoes to explode violently is Hot convection currents in the asthenosphere that pushes magma upward a b The large amount of iron found within mafic volcanoes c Expanding pressure from volcanic gases called volatiles d Low viscosity magmas 21 The more silica in the magma the more likely a A powerful eruption will occur b The lava erupted will flow easily causing hazards The more volatile gasses can escape readily d The lava will have low viscosity 22 A volcano can spew several kinds of gas into the air but most of the gas is Water vapor and carbon dioxide Crust and entrained mantle b Nitrogen and Sulphur dioxide c Sulphur dioxide and chlorine d Nitrogen that why it s the most common gas 71 in atmosphere 23 As seen in the video when the amount of Sulphur dioxide emissions are measured COSPEC suddenly drops at an active volcano this indicates that a The vent is blocked and pressure is building b The magma has not been contaminated c Sulphur dioxide has been replaced by water vapor d We can breathe easier the volcano is unlikely to erupt

48 A lateral blast from a volcano Is called a Pelean eruption a b Common with plinian eruptions such as Mt St Helens Can generate pyroclastic flows d All of the above 49 When a rhyolite dome forms in a volcanic crater this indicates Silica rich magma with high viscosity is blocking the vent b The volcano has degassed become less likely to erupt c A mafic magma will erupt next d All of the above 50 The viscosity of a lava is based on a Temperature and silica content b The amount of ash fall from a volcano Size of pyroclastic material d None of the above is a measure of viscosity33396