Biology Questions

look at the inferior surface of the brain anterior to the optic chiasm pull apart the frontal parietal and temporal lobes make a midline incision through the corpus callosum follow the brainstem up from the sihinal cord

If you were to pull the cerebral cortex into the shape of a blanket rather than all of the ups and downs of gyri and sulci how big would it be 1 square foot 2 5 square feet 5 square feet 10 square feet

5 Met Pro GG Translation Translation Ser AUGCCUAGUCGGUAAAAA AA 3 Arg Met Phase AUGCCUAGUCGGUAAAAAAAAA 3

36 If the temperature of a rock unit is elevated significantly the rock is more like a Deform plastically than elastically b Undergo brittle failure than plastic deformation C Deform elastically rather than undergo brittle deformation d Deform elastically than plastically 37 The amount of earthquake shaking and ground motion is a result of The magnitude of the earthquake event a b The depth of the focus C The geology of the soil and rock d All of the above contribute to the shaking 38 The type of fault most commonly found in divergent plate boundaries a Normal or gravity faults Reverse faults b C Strike slip faults d Transform or thrust faults 39 If an earthquake occurs the first waves to arrive at a seismographic station a P waves b S waves c Rayleigh waves d Love waves 40 Transverse S waves are only generated through a Liquids b Solids C 1 Any substance d Gas 41 A Love wave is C a A transverse surface wave with a swaying side to side motion b A longitudinal surface wave with an up and down motion The primary wave d The first wave felt as it is generated faster than a Rayleigh wave

24 Volcanoes have a positive service function by a Replenishing soil with nutrients b Lava flows creating ghost forests for us to marvel Allowing fluorine in water that is ultimately good for our teeth Volcanoes serve no positive function just ask the people at Pompeii d 25 A lahar can best be described as Flow of gas and hot ash Hot lava flow moving very fast A flow of hot mud with the consistency of wet cement d A rain of volcanic ash whose weight can cause roofs to collapse 26 Shield cones are most likely to form from Effusive eruptions from a central vent b Explosive eruptions from a central vent C Culminating pyroclastic eruptions d Lahars 27 Calderas form when A fissure C a b C erupt happens b Mafic magmas are heavy and sink Magma chamber empties and volcanic edifice collapses Lava flows are greater than pyroclastic flows during an eruptive episode a a C C d a 28 The distance inland that a tsunami travels is known as A local tsunami event b A distant tsunami event a Tsunami run up d Hydraulic displacement 29 A normal fault occurs as a result of Tensional stress the hanging wall moves down relative to the foot wall b Tensional stress the hanging wall move relative to the footwall c Compressive stress the hanging wall moves down relative to the footwal d Compressive stress the hanging wall move up relative to the footwall

a 18 The portion of the Earth C a b Lithosphere c Asthenosphere d Both a b 19 Tectonic plates are actively separating in all of the following EXCEPT a Rift zones b Sea floor spreading areas c Subducting plate boundaries d The mid ocean ridges 20 The force that causes volcanoes to explode violently is Hot convection currents in the asthenosphere that pushes magma upward a b The large amount of iron found within mafic volcanoes c Expanding pressure from volcanic gases called volatiles d Low viscosity magmas 21 The more silica in the magma the more likely a A powerful eruption will occur b The lava erupted will flow easily causing hazards The more volatile gasses can escape readily d The lava will have low viscosity 22 A volcano can spew several kinds of gas into the air but most of the gas is Water vapor and carbon dioxide Crust and entrained mantle b Nitrogen and Sulphur dioxide c Sulphur dioxide and chlorine d Nitrogen that why it s the most common gas 71 in atmosphere 23 As seen in the video when the amount of Sulphur dioxide emissions are measured COSPEC suddenly drops at an active volcano this indicates that a The vent is blocked and pressure is building b The magma has not been contaminated c Sulphur dioxide has been replaced by water vapor d We can breathe easier the volcano is unlikely to erupt

48 A lateral blast from a volcano Is called a Pelean eruption a b Common with plinian eruptions such as Mt St Helens Can generate pyroclastic flows d All of the above 49 When a rhyolite dome forms in a volcanic crater this indicates Silica rich magma with high viscosity is blocking the vent b The volcano has degassed become less likely to erupt c A mafic magma will erupt next d All of the above 50 The viscosity of a lava is based on a Temperature and silica content b The amount of ash fall from a volcano Size of pyroclastic material d None of the above is a measure of viscosity33396

b The frequency of the wave The wavelength of the wave d Amplitude of the largest peal 43 Surface rocks at low temperature are most likely to a Experience brittle deformation b Experience plastic deformation C Have a high yield point d Be very ductile creating folds 44 With destructive interference the seismic waves C a Causes wave amplification linked to greater destructiveness Creates the initial trough that arrive before a tsunami event Causes landslides to occur on unstable slopes d Cancel each other out creating a flat line b C C 45 Flood basalts form from a Only powerful eruptions with a lot of lava flows b Fissure eruptions Stratocone or composite volcanoes d Cinder cones volcanoes 46 Seismic waves move fastest through a Hard consolidated bedrock b Soft alluvium soils c Liquids d Attenuation 47 Triangulation is used to a Find the path of greatest rupture b Show the amount of attenuation Measure the amount of fault rupture d The location of the epicenter

c Compressive stress the hanging wall moves down relative d Compressive stress the hanging wall moves up relative to the footwall 31 Elastic deformation may occur when rocks are subject to a Compressive stress b Tensional stress C Shearing stress d Any type of stress 32 Rocks in which elastic deformation occurs Return to their original shape when stress is released Remain in their deformed shape when stress is released Become fractured but retain their original shape d Show no response to stress 33 Rocks in which plastic deformation occurs a b a Tensional stress the b Tensional stress the hanging wall moves up a C b Return to their original shape when stress is released Remain in their deformed shape when stress is released Become fractured but retain their original shape d Show no response to stress 34 Stress is the force applied to rock per unit area strain is a Only ductile b A change in shape or volume c Only brittle resulting in a fracture d Mitigated by an increase in stress 5 Strain is deformation resulting in a Stress b Slip C Magnitude d Cohesion

The wave length of a wave is a The distance between disturbances b How large is the disturbance c How destructive the wave will be d The waves frequency

6 With a fault when displacement is not apparent at earth s surface this faul a Blind fault b C Dip slip fault d Normal or gravity fault 7 At transform plate boundaries what kind of faults would be present Strike slip fault a Normal faults b Vertical reverse faults c Blind faults d Horizontal strike slip faults 8 The most powerful mega thrust earthquakes occur at a Divergent plate boundaries b Subduction zones c Along strike slip faults such as the San Andres d Continental collision zones such as Himalayas 9 Benioff zones are a Progressively deeper earthquakes at subduction zones b Zones of active shaking along strike slip faults such as California Another name for blind faults because we can t see them coming d Shallow focus earthquakes at zones of continental collision C 10 Earthquake warning systems are based on a The fact that P waves are faster than S waves b The fact that Love waves are faster than Rayleigh waves c Electrical resistivity d The initial run up of seismic waves 11 Technically a forecast would be a range of certainty but a prediction would be a Specifying only the date of an event b Specifying only the time of the event c Specifying only the size of the event d All the above

12 Carrying capacity means The maximum number of people the environment can contain without degradation b The ability of a fault to hold stress C Population momentum d Indirect result of exponential growth 13 The earthquake focus is a Where brittle deformation occurs b Another term for the hypocenter C Where epicenter is located above this point on the surface d All the above a 14 Deep focused earthquakes only occur at a Benioff zones at subduction plate boundaries b At powerful intra plate earthquakes Divergent plate boundaries in the ocean C d Thrust faulting in mountain ranges 15 The plate tectonic setting most commonly associated with powerful explosive Plinian a eruptions would be Rift zones with decompressional melting b Subduction zones c Transform plate boundaries as shown in the movie Volcano d None of the above 16 A Ghost Forest is a A bad Halloween movie b A drowned forest from subsidence c A forest destroyed by volcanic eruption as with Mt St Helens d A forest destroyed with major flooding from a hurricane 7 Hydraulic chilling means a People hanging out at a hot springs b Water in soil freezing to ice C Permafrost d Cooling a lava flow with sea water

B Page 246 Although the Halley Bay population of Emperor penguins was declining prior to 2016 it completely disappeared from 2016 2018 Which statement best describes what happened to the penguins Estimated number of breeding pairs 13 1 Describe the selection Correct Answer s 25 000 20 000 15 000 10 000 5 000 04 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 Year Drag appropriate answer s here Climate change resulted in severe storms that killed the femaler Halley Bay Dawson Lambton Early ice breakun likolu 2018

Even with the most recent advances in microscopy it is impossible to image atom O True O False

ne coll bacteria is suspended in water which has a viscosity of r 0 8 x 10 N s m and a density of 1000 kg m Assuming the water is absolutely still no net velocity the bacteria will fall downward unde he influence of gravity Assuming the bacteria has a mass of 680 femtograms 1 femtogram 10 18 kg and a diameter of 0 25 um what is the absolute magnitude of the terminal velocity of this bacteria in water Ignore buoyancy for the purposes of this problem Submit Answer Tries 0 99 What is the absolute magnitude of the terminal velocity for this bacteria if it were falling through air 1 989 x 10 Nes m and a density of 1 2 kg m Submit Answer Tries 0 99 How important is the force of gravity to the motion of bacteria through air compared to the force exerted by the motion of the air itself In other words consider the terminal velocity of the bacteria and compan o your estimate of the speed with which air moves in a typical room The force of gravity completely dominates the forces acting on the bacteria i e the motion of air can be ignored The motion of air completely dominates the forces acting on the bacteria i e gravity can be ignored Tod

What is the START codon Can you locate the START codon above What is the function of the Shine Dalgarno Sequence Where is it located The Shine Dalgarno sequence is complementary to what What does the START codon code for What are the STOP codons Can you locate a STOP codon above

Which of the following best describes how the process of crossing over during meiosis leads to an increase of genetic diversity During Prophase 1 sister chromatids separate from each other resulting in exchange of genetic material During Prophase 1 DNA replication takes place and homologous chromosomes trade places with each other O During Prohase1 DNA segments are exchanged between homologous chromosomes resulting in different combinations of genes O During Prophase 2 fragments of DNA break and attach to teh ends of other chromosomes resulting in different gene sequences

Programmed cell death may be initiated by which of the following O cyclin O MPF P21 4

A cell is 2n 24 The cell has completed Telophase and Cytokinesis 2 How many chromosomes does it have per cell Are they replicated or unreplicated O 12 replicated O24 replicated 12 unreplicated O 24 unreplicated

The total DNA content of each daughter cell is reduced during meiosis because O chromosomes replicate during the interphase between Meiosis I and Meiosis II O homologous chromosomes separate in Meiosis I O chromosomes do not replicate during the interphase preceding Meiosis I half the chromosomes from each gamete are lost during fertilization sister chromatids separate during anaphase of Meiosis I

Which of the following is not true of sister chromatids O they are joined by a centromere during prophase and metaphase O they segregate from each other during mitotic anaphase O they arise by replication during S phase they contain identical genetic information they contain different types of genetic information

Independent assortment refers to the way in which multiple sets of chromosome pairs can align on the metaphase plate druing Meiosis 1 True False

If 2n 24 and a body cell is at G1 after completing mitosis how many chromosomes are present per cell are they replicated or unreplicated 12 unreplicated 24 unreplicated 12 replicated 24 replicated

The ratio of the amount of DNA present in a Meiotic Prophase I cell to that in a Meiotic Telophase II cell is 4 1 3 1 2 1 none of the choices is correct

A cell lacks sister chromatids in a mitotically active tissue The cell in question is most likely in OS O GO G1

Which of these statements is false O In humans the embryo contains homologous pairs more than one choice is incorrect In humans gametes have originated from diploid cells

DNA is duplicated twice during meiosis Once during the interphase preceding meiosis I and again in the interphase preceding meiosis II O True False

2n 18 How many chromosomes are present per cell at Prophase of Mitosis and are they replicated or unreplicated O9 unreplicated O 18 replicated 9 replicated 18 unreplicated

Non tumor somatic cells may divide 20 50 times before death occurs none of these is correct a b c be subject to constant division cease division when mature

QUESTION 1 Place in order the steps of the scientific method V Analyze Results Run Experiments

2 Describe the structure and function of the following organelles a ribosomes b rough ER c smooth ER d Golgi complex e mitochondria f lysosomes g vacuoles bloroplast

A neutron is a subatomic particle that has a negative charge True False QUESTION 8 The subatomic particle that determines reactivity is the electron O True O False

QUESTION 9 Match the macromolecule with its characteristics Lipids Nucleic Acids Carbohydrates Proteins QUESTION 10 Match the cell structure or component to it s function character Nucleus A Structural or functional Includes keratin and hemoglobin B Fats Components of cell membrane Contains glycerol C Sugars Stores energy D Holds genetic information DNA RNA A Contains DNA eres a membrane

QUESTION 3 Match the structure of the microscope to its function Arm Stage Revolving nose piece Ocular Base QUESTION 4 If the total magnification of a microscope is 600X and the ocular is 10X what is the magnification of the objective 600x O 6x 0 6x O 60x A Contains the objectives B Used to carry the microscope C Structure which you look through may be replaced by camera D The portion of the microscope that the scope sits on E Place where slides are placed QUESTION 5 fviow increases as well

As your magnification increases your field of view increases as well O True False QUESTION 6 A proton is a subatomic particle that has a positive charge O True O False

What is the response when baking soda is place in vinegar O There is a chemical reaction and the solution turns black O A chemical reaction occurs and bubbling is noted O The baking soda merely sinks to the bottom

10 11 9 8 6 7 Hand Instruments Instrument used to remove soft dentin and decay from the tooth Multifunctional instrument with the sharp point at the tip sensitive to distinguish areas of calculus or decay on the surface of the teeth This instrument measures the sulcus of pocket depth of the periodontium of each tooth Instrument used to carry place and retrieve small objects such as cotton pellets gauze and cotton roll instrument used for a variety of purposes indirect vision reflecting light onto a surface retraction of tongue and soft tissue such as lips and cheek This double ended instrument is designed to pack freshly mixed amalgam and carry it to the prepared tooth Instrument used to contour or remove excess material interproximally Chapter 34 with the dish and claw like end Instrument used to carve the restorative material on the occlusal surface material restorative material Instrument with smooth working end and used to smooth the surface of a preparation This instrument is also plugger used to pack down freshly placed amalgam into the H Instruments are designed specifically for the placement of composite restorative

1 Karine s friends are asking her to do heroin with them She doesn t want to join in this potentially life threatening behavior but isn t sure how to say no to all of her friends What are three strategies she could use when responding to make sure her friends know that she doesn t intend on taking drugs 2 Mike has never been a very athletic person but he really wants to start becoming more physically fit He s not big on trying out for school sports teams but he s not sure what other opportunities are available outside of school that can help him have fun and engage in a healthier more active lifestyle What are five different suggestions a friend might offer to Mike in this scenario 3 Adia lives in Kigali Rwanda and attends a private boarding school that frequently wins national championships for a number of sports Anne lives in a small town outside Wichita Kansas her family has one car which her mother uses to commute to work How might their cultural backgrounds play a role in how much physical activity they each get How might each have different experiences when it comes to sports 4 Trent Lorenzo and George are at a party where alcohol is being served How will the dynamics of their social group playrole in whether these boys decide to drink Describe how the group might exhibit positive peer pressure Describe how they might exhibit negative peer pressure 5 Teens face online and digital dangers every day What are some strategies to avoid inappropriate digital and online communication and how can teens protect their online identity and avoid online predators If you are ever bullied cyberbullied or harassed what action plan would you put into place and where could you seek support to deal with this situation If students do choose to bully what are some consequences of their behavior

The recessive alleles for scute bristles s and ebony body e identify two autosomal genes on the third chromosome of Drosophila melanogaster When females heterozygous for these genes were crossed with scute bristled ebony bodied males the following classes and numbers of progeny out of 1000 were obtained wildtype bristles wildtype body 188 scute bristles wildtype body 307 wildtype bristles ebony body 313 scute bristles ebony body 192 What is the distanced between the s and e genes 18 8 map units 38 map units 0 5 62 man units

The recessive alleles for mahogany eyes m and ebony body e identify two autosomal genes on the third chromosome of Drosophila melanogaster When females heterozygous for these genes were crossed with mahogany eyed ebony bodied males the following classes and numbers of progeny out of 1000 were obtained mahogany eyes ebony body 319 mahogany eyes wild type body color 176 What is the distanced between the m and eb genes Wild type eye color wild type body color 311 Wild type eye color ebony body 194 19 4 map units 31 1 map units 31 9 map units

The recessive alleles for cinnibar eyes c and vestigial wings v identify two autosomal genes on the third chromosome of Drosophila melanogaster When females heterozygous at these two genes Cc Vv were crossed with cinnibar eyed vestigial winged males the following classes and numbers of progeny n 1000 were obtained wild type eye color wild type wings Wild type eye color vestigial wings Cinnibar eye color vestigial wings Cinnibar eye color wild type wings 46 map units Based upon these results the map distance between the cand v genes is estimated to be 8 map units 92 map units 42 4 map units 464 38 456

A wild type allele is the most common allele for a gene in a population expressed in the heterozygous state expressed only in the homozygous state always beneficial to the organism always completely dominant

Question 15 If the recombination frequency between P and O is 7 4 and between N and O it is 7 9 what is the likely order of these genes on the chromosome if the distance between N and P is 15 7 N O P O P N Sither P O N or N O P 0 5 pts OO N D

Consider the relative map distances between four genes on the chromosome shown here What is the expected recombination frequency between genes X and Z W X Y 2 15 10 5 2 10 Z

You are studying two genes that are located on the same chromosome They are located 55 map units apart How will the alleles of these genes behave in a dihybrid cross They will appear to segregate independently as if they are located on different chromosomes This cannot be adequately answered without knowing the recombination frequency They will assort together because they are linked Question 15 0 5 pts

Red green color blindness is X linked in humans If a male is red green color blind and both parents have normal color vision which of the male s grandparents is most likely to be red green color blind Maternal grandmother Maternal grandfather Paternal grandmother Paternal grandfather Either grandfather is equally likely

In the following cross P generation the genes are inherited independently not linked except for genes C and D which are completely linked and show no recombination AAbbccDD x aaBBCCdd What is the genotype of the F1 offspring AaBbCcDd

You are working as a cytogeneticist a scientist who looks for and evaluates chromosomal and genetic abnormalities and you have been asked to look at cell samples from a woman who is experiencing infertility You first stain the cells to look for Barr bodies and you find that she has two Barr bodies in each cell Which of the following is a possible conclusion about her sex chromosomes She is genotype XXX She has only a single X chromosome A She is XXY with a non functional Y chromosome

Red green color blindness is a sex linked recessive trait in humans Two people with normal color vision have a color blind son What are the genotypes of the parents OXX and XY OXRXR and XRY XRX and XRY XRX and XY

If a male affected by a recessive sex linked trait reproduces with a female who is homozygous wild type for that trait what is the chance that any of their offspring will have the trait 0 25 50