Biology Questions

3 Why are introns considered beneficial if they are spliced out of the RNA transcript

2 What are some similarities and differences that you noticed between transcription and replication

1 Why is transcription the first step in gene expression

write 1 take home message about the professional patent The take home message must be followed by an explanation short essay on how that take home message may help you advance your career plans

KRANKOS Meiosis V 1 VAG Prophase II Germ line cell Meiosis II 6 Meiosis I Do not replicate Chromosomes Anaphase II These four along the bottom go in stage specific order Synapsis and crossing over 2 Gametes 5 A Diploid B Metaphase I C Prophase D Telophase II E Anaphase I F Haploid G Metaphase II Homologous pairs align 3 Separate homologous pairs 4 Telophase I

Question 3 x is the two word name of the process happening below Spelling counts A b B C C C a C C a C C C a C

The moment of fertilization is also known as which produces a which is a fertilized single cell 1 points

Question 2 When talking about the chromosome number in a cell if the cell contains the full number of chromosomes we use the term we refer to the chromosome number as 2 points and if the cell is haploid Save Answer

1 Joachim is at a party with his friends Some of his friends are being inconsiderate and disrespectful by bullying a new kid from their neighborhood who is also at the party Joachim expresses his disapproval to the bullies in a passive way Juanita expresses her disapproval to the bullies in an aggressive way Lucy expresses her disapproval to the bullies in an assertive way Give an example of how Joachim Juanita and Lucy would respond in their various forms of communication Whose response is MOST likely to be effective and why 2 Brody recently found out that Martin is dating his ex girlfriend and is livid Cornering him in a hallway in between classes Brody screams at Martin Where do you think you get off dating my ex I m furious What are three different ways Martin could use conflict resolution techniques to respond in this situation What is most likely the BEST of all of Martin s three options and why Explain how this same BEST option could apply in other situations when conflict is involved 3 JJ tells his friend Anna that he is thinking of joining a street gang Why might JJ feel like this is a good choice for him If JJ joins the gang what is likely to be expected of him What gang behaviors would likely put his health at risk What are some things Anna can say to JJ that might encourage him to think differently about his choice What can Anna s community do to discourage gangs from forming in the first place 4 Jamie is talking to her dad about the homelessness issue in their city Her dad tells her there wouldn t be a problem if these people would just get jobs Jamie disagrees with her dad s statement How might Jamie respond in a way that informs her dad about who makes up the homeless population and why people become homeless What are three action steps Jamie and her family might take to make a difference in her city s homeless population 5 Chen is worried that his friend Leo is drinking alcohol every day after school What are the best ways for Chen to offer assistance to Leo If you were in Leo s situation and were beginning to worry about your own unhealthy choices how would you ask someone to help you Why would you pick this method

Mutation questions Transcribe then translate this normal sequence of DNA all questions below will refer to this sequence 5 GGTATGGCCGCACAATAGTTGC 3 3 CCATACCGGCGTGTTATCAACG 5 I 18 19 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCAUAAUAGUUGC 3 Translate this sequence

the process of transduction usually begins when when the signal molecule or ligand attaches the receptor protein and changes the receptor in some way after the target cell divides after the third stage of cell signaling is completed when the hormone is released from the gland into the blood

Match the following with the descriptions paracrine signaling Examples of second messengers Apoptosis endocrine signaling Choose Example of long distance signaling CAMP Inositol triphosphate calcium Programmed cell death example of local cell signaling Choose Choose

The three stages of cell signaling is order are the paracrine local and synaptic stages Osignal reception signal transduction and cellular response signal reception cellular response and signal transduction

The phenotypic ratio resulting from a DIHYBRID showing independent assortment is expected to and the phenotypic ratio resulting from a MONOHYBRID cross showing independent assortment is expected to be be 3 1 9 3 3 1 9 3 3 13 1

Having two identical alleles for a gene is called whereas having different alleles is

Two gametes combine during fertilization to form the Zygote restoring the Diploid haploid Haploid diploid stag

Homologous chromosomes carry the alleles of the gene or character and have the le same same different same Same Different 5 56 JCC

What is polygenic inheritance occurs when one gene influences many characteristics a single phenotypic character results from the additive effects of two or more genes two dominant alleles affect the phenotype

Two gametes combine during fertilization to form the Zygote restoring the Diploid Haploid O Haploid Diploid stage

What is pleiotropy occurs when one gene influences many characteristics a single phenotypic character results from the additive effects of two or more genes two dominant alleles affect the phenotype

All the offspring of a cross between a RED flowered plant and a WHITE flowered plant have PINK flowers blending of traits intermediate phenotype This is an example of what type of inheritance dominant codominance incomplete dominance recessive

The genetic makeup of a trait is called whereas the observable expression of a trait is Phenotype genotype

A biological human male having the normal sex chromosomes has whereas a biological female having the normal sex chromosomes has chromosomes two X chromosomes XX one X chromosome and one Y chromosome XY two X chromosomes and one Y chromosome XXY two X chromosomes XX one X chromosome and one Y chromosome XY two X chromosomes XX one X chromosome and one Y chromosome XY two X chromosomes and one Y chromosome XXY

If dimples is a dominant trait what is are the possible genotypes of an individual having dimples Homozygous dominant DD Homozygous recessive dd Heterozygous Dd Both Homozygous dominant and heterozygous

Regarding mitosis and cytokinesis one difference between plants and animals is that O A cleavage furrow forms during cytokinesis in both animals and plants in plants a cell plate begins to form at telophase whereas in animals a cleavage furrow is initiated at that stage in plants a cleavage furrow begins to form at telophase whereas in animals a cell plate is initiated at that stage

Indicate which of the following lists the correct order of stages of mitosis a Metaphase anaphase interphase telophase prophase Interphase prophase promethaphase metaphase anaphase telophase Telophase anaphase prometaphase metaphase prophase interphase Interphase anaphase metaphase telophase

Which two terms will make the following statement true produces offspring that are identical to the original cell or organism and produces offspring that are similar but show variation in traits from two parents asexual reproduction sexual reproduction sexual reproduction asexual reproduction

5 1 2 4 3 Date What kind of gametes does a person of genotype AaBb produce What kind of gametes does a person of genotype DdEE produce Brown hair is dominant over blonde hair Using the letters B and b write the genotype for the following persons a homozygous brown b heterozygous brown c homozygous blonde A brown eyed man Bb marries a brown eyed woman Bb Blue eyes are recessive a Give the genotypic ratios of the children b Give the phenotypic ratios of the children Hour Two non freckled parents Ff are crossed What proportion of their children could be freckled A brown eyed man Bb or BB married a blue eyed woman bb Their first child is blue eyed What is the man s genotype Explain

3 7 In humans normal skin pigmentation is due to a dominant gene A albinism to its recessive allele a A normal man marries an albino woman their first child is albino a What are the genotypes of the b Man Woman Child If they had more children what is the probability that they would be USE A PUNNETT SQUARE a normal b albino If a man that is heterozygous for brown eyes marries a woman that is heterozygous for brown eyes blue eyes are recessive a What is the genotypic ratio of the children b What is the phenotypic ratio of the children In humans right handedness is dominant H If a heterozygous right handed man marrie a left handed woman h a What is the genotypic ratio of the children b What is the phenotypic ratio of the children In humans the gene for tasting PTC is dominant A The brown eye gene B is dominant to blue b What proportion of the children of two parents each of genotype AaBb would be a brown eyed tasters b blue eyed tasters c brown eyed non tasters d blue eyed non tasters

Three Proteus vulgaris Two S m and P v will be under the positive glucose fermentation to acid and P p will be under the branch for the negative reaction PR L S m and P v will be under the negative glucose fermentation to acid and P p will be under the branch for the positive reaction Serratia marcescens One Pseudomonas aeruginosa The number of columns gives the number of steps roups alendar Inbox History DD People Office 365 YuJa LAMC Tutoring Welcome Center Library NetTutor When creating a dichotomous key what test can be used to separate these bacilli into two branches If you start with PR G fermentation of glucose into acid how would the names of the bacilli be separated What is the minimum amount of steps needed to separate these three bacilli in a dichotomous key A step is a test Which of these microbes is Choose Choose Choose Proudomonas aeruginosa est

How did we prepare an MHA plate for the Kirby Bauer method to test for antimicrobial susceptibility in the micro lab Choose the best answer Aseptically add the antibacterial disks then spread an inoculum of a pure culture all over the surface of the agar for proper coverage Then Incubate for 48 hrs O Aseptically spread an inoculum of a pure culture in different directions to cover the surface of the agar Then add the antibacterial disks and incubate for 48 hours Aseptically spread an inoculum of a pure culture in different directions to cover the surface of the agar Then add the antibacterial disks and incubate for 72 hours Aseptically spread an inoculum of a pure culture in different directions to cover the surface of the agar Proceed to add the antibacterial disks and immediately measure the diameter of the cloor inhibiti HILE

Question 11 1 pts What is the first step to unknown identification when you receive the slant Choose the best answer Aseptically perform a gram stain from the unknown culture Then use a sterile cotton swab to inoculate a NA plate O Aseptically inoculate a sterile slant and broth from the unknown culture I may also do a gram stain Aseptically streak a sterile NA plate using the unknown culture I may use this NA plate to do a gram stain on the same day as long as I use an isolated colony Aseptically use a sterile slant to inoculate the unknown culture I may also do a gram stain

Which of the following choices is the method we used to evaluate the effect of UV light exposure on E coli and B subtilis in the lab We divided one NA plate in half and swabbed one culture per side Then exposed it to the UV light We divided one NA plate in half swabbed the entire surface of the agar using the inoculum from a pure culture and exposed only one side to the UV light We turned on the UV light and let the plates sit in the cabinet with lids on We turned on the UV light and let the exposed swabbed areas under the light for different amounts of time True True True True

18 10 Source Chegg com 106 LILO 107 Only one plate could be used 10 5 because above this plate you have TNTC and below it TFTC O We can use any one of these plates for bacterial concentration calculations O Only the plate marked as 10 6 is usable all other ones are TNTC and the one below it is TFTC

Use the following diagram to match the questions to the correct answers Oxidation Fermentation Test Procedure Source Biolife E Which test supports positive facultative anaerobic utilization of dextrose Which test tube is negative for fermentation of dextrose Which test tube pair is indicative of non saccharolytic capabilities What pH reagent is added to the O F test media Choose Methyl Red Green tube with oil Bromothymol blue Yellow O F tube without oil only Green tube with oil and blue tube without oil Yellow O F tube with and w o oil Phenol Red Choose

lowing paragraph and table to answer the questions that follow Points for each the data estion are in bold at the end of the question Organisms get energy from the food they eat but the energy contained in foods varies greatly Most foods contain a combination of proteins carbohydrates and fats One gram of protein or carbohydrate such as glucose contains roughly 4 Calories One gram of fat however contains about 9 Calories The table below shows the approximate composition of one serving of some common foods Composition of Some Common Foods Protein g Food Apple 1 medium Bacon 2 slices Chocolate 1 bar Eggs 2 whole 2 milk 1 cup Potato Chips 15 chips Sourdough bread 2 slices Skinless roasted turkey 3 slices 0 5 3 12 8 2 8 11 Carbohydrate g 22 0 23 0 12 14 36 3 Fat g 0 6 13 9 5 10 1 1 17 Per serving which of the foods included in the table has the most protein Which as the most carbohydrates Which has the most fat 4pts 18 Approximately how many more Calories are there in 2 slices of bacon than there are in 3 slices of roasted turkey Why is there a difference 4pts 19 Walking at a moderate pace consumes around 300 Calories per hour At that rate how many minutes would you have to walk to burn the Calories in one chocolate bar Show work Explain your answer 3

91 Question 2 Chromosome Duplication and Segregation Name and discuss the two chromosomal sequences structures areas and their functions whose job it is to ensure that the duplication and number of chromosomes are kept constant from one generation of the cell to the next Hint we ve briefly discussed them this week and in Topic 6 and they are required for DNA replication and chromosome segregation

B It is common for cancer cells to have lost p53 activity Based on what you know about p53 function and regulation what regulatory mechanisms might be disrupted in p53 that could lead to a cancerous phenotype List two specific examples and explain Bullet point your response for easier grading

Observe the following table of biochemical tests and Gram negative bacilli Answer the questions below by choosing the best answer from the pull down menu Fermentation and Oxidation in Gran Negative Bacilli Serratia marcescens Proteus vulgaris PR PR PR Glucose Lactose Sucrose acid acid acid Pseudomonas putida When creating a dichotomous key what test can be used to separate these bacilli into two 4 2 Choose O F Test FA OA FA

Observe the growth of bacterial colonies on these plates Which dilution factor plates would not be appropriate to use to determine bacterial concentration Why Exercise 5 results 10 105 10 106 104 107

If you have a series of PR sugar fermentation test tube results after proper incubation what would be the interpretation for each of the following observations Match the questions to the correct answers PR G is yellow and has a large bubble in the Durham tube PR L is red and has no bubbles in the Durham tube PR S is yellow and had no bubbles in the Durham tube Choose Choose Choose

Here is the formula to calculate bacterial concentration using the spread plate technique viable count CFU mL CFU x dilution factor over the volume of culture plated in mL What is the proper calculation of CFU mL in this solution series Sample 1 mL 1 mL 9 mL 1 10 10 1 1 mL TNTC Plaque counts Source wikisanitarc si 75 CFU x 10 4 per mL 1 mL 1 100 10 345 CELLY 10 4 per ml 9 mL din mL 1354 1 mL 9 mL 1 1000 10 3 1 mL 345 1 mL 9 mL 1 10 000 104 1 mL 75 9 mL 1 100 000 10 5 1 mL 10

Erythromycin Amoxicillin Classic Acid Which drug would be preferred for a patient with an E coli infection Which drug would be preferred for a patient with an S pyogenes infection Which drugs have no effect on the bacteria on the plate What is the name of the halo around drugs like Tetracycline and Gentamicin Optochin Choose Penicillin Streptomycin Choose Lawn of bacteria Vancomycin Bacitracin Optochin and Penicillin None of these because the drugs definitely do not affect S pyogene Vancomycin Bacitracin Erythromycin and Penicillin None of these because the lawn of bacteria is only for E coli Zone of inhibition Diameter of the drug disk Trimethoprim Sulfamethoxazole

Erythromycin Amoxicillin Clavulanic Acid Which drug would be preferred for a patient with an E coli infection Which drug would be preferred for a patient with an S pyogenes infection Which drugs have no effect on the bacteria on the plate What is the name of the halo around drugs like Tetracycline and Fal Optochin Penicillin Streptomycin Choose Choose Lawn of bacteria Vancomycin Bacitracin Optochin and Penicillin None of these because the drugs definitely do not affect S pyogene Vancomycin Bacitracin Erythromycin and Penicillin None of these because the lawn of bacteria is only for E coli Zone of inhibition Diameter of the drug disk Trimethoprim Sulfamethoxazole

Use the following diagram to match the questions to the correct answers Oxidation Fermentation Test Procedure Source Biolife E Which test supports positive facultative anaerobic utilization of dextrose Which test tube is negative for fermentation of dextrose Which test tube pair is indicative of non saccharolytic capabilities What pH reagent is added Choose Choose Green tube with oil and blue tube without oil Bromothymol blue Phenol Red Methyl Red Green tube with oil Yellow O F tube with and w o oil Yellow O F tube without oil only oose

If you have a series of PR sugar fermentation test tube results after proper incubation what would be the interpretation for each of the following observations Match the questions to the correct answers PR G is yellow and has a large bubble in the Durham tube PR L is red and has no bubbles in the Durham tube PR S is yellow and had no bubbles in the Durham tube Choose Choose Bacteria ferment glucose to produce acid and gas Bacteria ferment sugars to produce acid but it does not produce gas Bacteria do not ferment lactose at all Bacteria ferment sucrose to produce acid but it does not produce ga Bacteria do not ferment lactose but they may produce gas eventually

What is the first step to unknown identification when you receive the slant Choose the best answer Aseptically perform a gram stain from the unknown culture Then use a sterile cotton swab to inoculate a NA plate O Aseptically inoculate a sterile slant and broth from the unknown culture I may also do a gram stain O Aseptically streak a sterile NA plate using the unknown culture I may use this NA plate to do a gram stain on the same day as long as I use an isolated colony O Aseptically use a sterile slant to inoculate the unknown culture I may also do a gram stain

Why do we need to succeed in plate streaking in microbiology Choose all the answers that apply plate streaking prevents you from separating a mixed culture of organisms plate streaking gives you isolated colonies plate streaking allows you to identify culture contaminants plate streaking allows you to identify colony characteristics plate streaking allows you to separate a mixed culture of organisms plate streaking gives you isolated colonies like culture slants plate streaking allows you to test with differential media using pure cultures

Question 4 Points 1 is a fast food restaurant that was built in the 1950s and is still popular today O Burger King O Hardies McDonalds O Checkers Jhry

Question 2 A peer reviewed article from PLoS One 2008 suggests that the human MRSA252 strain shares several unique DNA sequences to different bacterial agents that cause bovine mastitis i e Listeria monocytogenes and Staphylococcus saprophyticus Bovine mastitis is an inflammation of the mammary gland of milking cows due to trauma or infections Which of the following could explain the process by which these DNA sequences of other species genomes became part of MRSA252 s genome Choose all that apply O Conjugation O Transduction DNA replication O Protein synthesis Transformation pt lac Operon regulation