Biology Questions

The poly A tail is added to the RNA transcript in the lumen of the rough endoplasmic reticulum to protect and stabilize the transcript

Question 5 Where does translation occur inside the eukaryotic cell SER RER O Nucleus O Cytoplasm Question 6 Cells bacterial or eukaryotic are always transcribing and

Conjugation specialized transduction O Transformation O DNA replication Question 3 Which of the following connects adjacent nucleotides in DNA replication O ligase O helicase ORNA pol

Question 4 Which of the following is correct RNA polymerase copies DNA from the 5 to the 3 end DNA polymerase copies DNA from the 5 to the 3 end O DNA polymerase copies DNA from the 3 to the 5 end O DNA helicase copies DNA from the 5 to the 3 end Question 5 Where does translation occur inside the eukaryotic cell

Cells bacterial or eukaryotic are always transcribing and translating all coding DNA regardless of environmental conditions True

Please match the following columns regarding mutations Point mutations Codon Valine becomes Alanine UAC becomes UAG stop Choose Choose ACGUU ACG a single base pair is changed Missense mutation Nonsense mutation a base pair could have been added or removed

The normal DNA sequence is ATC GGC TAA TCC The mutated DNA that shows a frameshift mutation is O ATC GCT AAT CC O ATC GGC TAC TCC

Questions 7 13 refer to the following summary diagram of photosynthesis Examine the diagram thoroughly and identify each one of the numbered components Hint it might be beneficial to NOT identify them in numerical order rather focus on things you know like what goes in and what comes out of each stage as you summarized listed in questions 4 6 Light Reactions 7 1 represents 8 2 represents 9 3 represents 10 4 represents 11 5 represents 12 6 represents 13 7 represents 5 NADP Calvin cycle glucose

under very different cif the voice and tone of each selection However there are some similarities between the texts as well Review your annotations and notes to find similarities and differences in voice and tone in the two works In a small group discuss how the voice and tone in these two works compare Then work together to complete the chart with examples from each text that illustrate tone or voice In the third column note if you think the examples are similar or different Tone Voice LETTER TO JOHN ADAMS LEAN IN COMMENTS ANALYZE THE TEXTS Discuss these questions in your group 1 Infer Do you think the two women would agree on what makes an ideal marriage Explain using examples from each text 2 Synthesize How do Adams s comments about the approaching revolution suggest that she would have appreciated Sandberg s advice on pursuing success 3 Compare Though the two writers have different styles they have energy and passion in common Use evidence from the texts such as details related to style or tone that demonstrate their energy and passion 4 Evaluate What do these two works suggest about how involved the Pulding Compon

6 Fill in the table below Are the compounds Photosystem I Photosystem II The Calvin cycle listed here used or produced in Glucose 0 CO H O ATP ADP P NADPH NADP

Exercise 1 Download and listen to the Photosynthesis lecture posted in Canvas For this exercise you need to submit YOUR written notes taken from this lecture Headings in your notes should include the slide number followed by the notes taken for that slide These notes should be detailed Exercise II Complete the following activity using your textbook and notes from the Photosynthesis lecture from class as instructed in above in exercise I 1 Define autotrophic and heterotrophic nutrition 2 Write the definition for photosynthesis and provide a summary equation 3 Explain the role of redox reactions in photosynthesis 4 Summarize the two main stages of photosynthesis 5 Fill in the table below a What is are the overall function s of photosystem I b What is are the overall function s of photosystem II c What is are the overall function s of the Calvin cycle

Occasionally a double stranded DNA molecule contains a uracil base U What is a likely source of the base methylation of a thymine a none cleaved primer base Deamination of a cytosine residue an rUTP is incopoorated during DNA replication

Part 5 Conclusion Analyze the data from your lab to help answer the following question How can abiotic factors affect sea urchins and the kelp forest ecosystem CLAIM EVIDENCE

In our Theory of Knowledge class students discussed their thoughts on the question What is art in a socratic seminar Students came to the consensus that art can mean many things and take on many different forms One student suggested that art is a physical representation of people s emotions According to them art invokes one or more of the senses like touch or taste Another student suggested that art is characterized by its usage of artistic elements like form and texture A third student suggested that art can also be a form of political protest They provided the example of a fashion show where everything the artists wore broke to demonstrate the ills of fast fashion I think that all three student s views basically encompass the essence of art I think that art can be defined by its purpose as well as the tools used to create it The conversation veered onto the topic of art s value One student suggested that humans value art based on how much we can interpret it Therefore professional artists can interpret things better compared to a regular person Another student disagreed with this arguing that art s value is not conditional on the person viewing it and that art has inherent value I personally agree with the second student An art piece s message doesn t waver depending on the person who views it Art is always subject to human interpretation Human interpretation is subjective but this doesn t disregard the art s value

Identify each of the following reactions as an isomerization phosphorylation or phosphate transfer Drag the appropriate items to their respective bins View Available Hint s Isomerization Submit glucose 6 phosphate fructose 6 phosphate dihydroxyacetone phosphate glyceraldehyde 3 phosphate Previous Answers Phosphorylation 2 attempts remaining 1 3 bisphosphoglycerate 3 phosphoglycerate phosphoenolpyruvate pyruvate Phosphate transfer Reset Help glucose glucose 6 phosphate fructose 6 phosphate fructose 1 6 bisphosphate upon t basdation hobu

As each tRNA molecule binds to the mRNA the ribosome joins the amino acid carried by the tRNA to the growing amino acid chain Describe UAG as well as UAA and UGA is an example of a stop codon Molecules called release factors bind to stop codons Place the release factor on the mRNA molecule happens The amino acid chain is released X from the tRNA and the release factor and final tRNA molecule exit X the ribosome

Discuss the differences between Microevolution and Macroevolution 1 Macroevolution 2 Microevolution

The taxonomy classifications for what used to be Kingdom Protista has changed dramatically in the last decade What characteristics were problematic with the old system

Discuss the external cellular features that contribute to the success of prokaryotes Edit View Insert Format Tools Table

List the 4 types of nutritional diversity associated with prokaryotes and discuss the energy sources of each and the advantages of each type based on the organisms environment

Discuss the differences between the evolutionary features 1 Homologous Structures and 2 Analogous Structures

Over the past 500 million years there have be en mass extinctions and each time at least species on Earth became extinct O twelve 96 O two 25 O seven 25 O seven 25 of the

f all of Earth s history were compressed into 24 hours would first appear less than 10 minutes ago Land plants Animals Paleozoic Multicellular eukaryotes Single celled eukaryotes Meso zoic Ceno zoic Proterozolc Archaean Eo Eon Billions 2 Humans of ago years Atmospheric oxygen Origin of solar system and Earth Prokaryotes

Miller was the first to show that Sparks simulating lightning Water vapor 1 H O 2015 Pearson Education inc Sea O the earliest forms of life were photosynthetic O eukaryotic life evolved from early prokaryotes O the earliest forms of life had an RNA genome CH4 NH3 3 H Atmosphere Electrode Condenser Cold water 4 Sample for chemical analysis

In Eukaryotes transcription begings with the binding of TFIIB TFIIC TFIID TEUA www to the promoter

Which of the following statements correctly describes alternative RNA splicing It can allow the production of different protein products from a single mRNA It is a mechanism that can decrease the rate of transcription It allows the production of similar proteins from different RNAs It is a mechanism that can increase the rate of transcription

Which of the following is a function of a poly A tail in mRNA It helps protect the mRNA from degradation by hydrolytic enzymes It indicates the site of translational initiation It adds the modified guanine to the 3 end of the mRNA It is a sequence that codes for the binding of RNA polymerase to the DNA

A eukaryotic mutation upstream of a particular gene has been identified that changes the sequence of the TATA box to GATA How would you predict that this mutation would affect the transcription of this gene Transcription factors would bind in the middle of the gene sequence and transcribe the gene from that point Transcription factors would bind to the start point in the promoter region Transcription factor binding would be reduced or eliminated and transcription of the gene would decrease dramatically Transcription would proceed normally

Listen Which of the following statements correctly compares transcription in prokaryotes and eukaryotes RNA polymerase in both prokaryotes and eukaryotes produce the only mRNAs Both eukaryotes and prokaryotes recognize a polyadenylation signal in order to terminate transcription Prokaryotes have at least three types of RNA polymerases whereas eukaryotes only have one Bacteria have one type of RNA polymerase whereas eukaryotes have at least three

In eukaryotes there are several different types of RNA polymerase Which type is involved in transcription of mRNA known as pre mRNA ligase RNA polymerase III RNA polymerase I RNA polymerase II

Which of the following processes only occurs in eukaryotic gene expression RNA polymerase binds to the promoter A poly A tail is added to the 3 end of an mRNA and a cap is added to the 5 end Transcription can begin as soon as translation has assembled the first few amino acids in the polypeptide mRNA tRNA and rRNA are transcribed

A particular triplet of bases in the template strand of DNA is 5 AGT 3 The corresponding codon for the mRNA transcribed is 3 UGA 5 5 TCA 3 3 UCA 5 3 ACU 5

The codon for phenylalanine is UUU Which of the following codons also most likely encodes for phenylalanine AUC AAA UUC CUC

Represented below is part of the sequence of amino acids in a polypeptide Pro Thr Gln Lys Asn Ser Which of the following sequences of DNA could be used as a TEMPLATE to produce the RNA that encodes this protein sequence 1 5 AGAATTTTTTTGAGTAGG 3 2 5 GGATGAGTTTTTTTATCA 3 3 5 CCUACUCAAAAAAAUUCC 3 4 5 UUUUUAUCAUUGAGUAGG 3 1 2 AUG Met or Start UAG UAA and UGA Stop 3

Question 1 O O There are 5 10 20 amino acids that are used by organisms for protein synthesis 0 5 pt

Components O Brown tube Phusion HF buffer Blue tube TPS Green tube RNA forward Pink tube RNA reverse Yellow tube A template Clear tube usion DNA polymerase tal volume of the stock sample 5X 10 mM 10 M 10 M 0 05ng L 2 U L concentration in reaction tube 1X 0 2 mM 0 2 M 0 2 M 0 5ng 100 L 1U 100 L per reaction Positive control L 63 5 L 20 0 L 2 0 L 2 0 L 2 0 L 10 0 L 0 5 L 100 L per reaction Negative control L 73 5 L 20 0 L 2 0 L 2 0 L 2 0 L 0 5 L 100 L

1 Rita has watched as her mom has been diagnosed with two different types of cancer and type 2 diabetes Her mom hasn t eaten well her entire life and hasn t led a very active life Rita wants to try her hardest to avoid diseases and to improve her quality of life How can Rita s relationship with nutrition affect her quality of life and risk for disease What are three specific actions she can take to try to decrease her chances of disease and improve her quality of life 2 Terrance was recently diagnosed with high cholesterol His doctor wants him to make changes to his individual diet plan to help him eat more nutritious foods and fewer empty calories What is the best way for Terrance to make these changes What are three questions he could ask himself to help determine what changes need to be made If you were in Terrance s situation what three changes would you make 3 Kendra wants to lose weight However every night after work it s most convenient for her to stop at a fast food restaurant where she eats a cheeseburger and fries Before going to bed she eats ice cream and potato chips What are some healthier alternatives she could try to help her lose weight What are other ways she can enjoy healthier foods 4 Jamal has found a supplement at his health food store that claims to cause a person to lose 10 pounds a month He asks you if he should take it How would you respond What are some ways you could teach Jamal to critique the validity of health products How will Justin know if this product is safe and effective 5 You notice your friend has been skipping meals lately and appears to be losing a lot of weight How would you respond in this scenario What are two ways you might help your friend make positive health choices

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Why is it necessary to have separate pathways for breaking down glucose and synthesizing glucose View Available Hint s The overall reaction pathway needs to be exergonic making it irreversible Glycolysis involves three highly exergonic steps that make the reverse endergonic reactions nearly impossible under cellular conditions If the two pathways were exact opposites of each other no appreciable amount of glucose would be broken down or formed ever All of the answers are correct Submit Previous Answers

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Comparison of your contig DNA sequence to the Wt sequence of the T7 RNA polymerase NCBI Gene ID 1261050 Provide a copy of the nucleotidenucleotide alignment of your two sequences Clustal Omega output By looking at this alignment can you identify the point mutation that had been inserted in your DNA insert coding for T7 RNA polymerase You may have more than one mutation describe all of them but make sure to highlight the ones that were introduced by the technical staff see General introduction at page 1 It should be highlighted in the alignment but also clearly stated in a sentence MY mutant number IS 3 contig DNA sequence ttatcatcggctcgtataatgtgtggaattgtgagcggataacaatttctttcaggagatatcatatggctcacaaccaccgtcac aaacacaagcttatgaacacgattaacatcgctaagaacgacttctctgacatcgaactggctgctatcccgttcaacactctg gctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgagtcttacgagatgggtgaagcacgcttccg caagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcatcactaccctactcccta agatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttcctgc aagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgt tcaggctgtagcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcac ttcaagaaaaacgttgaggaacaactcaacctgcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctg acatgctctctaagggtctactcggtggcgaggcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgc atcgagatgctcattgagtcaaccggaatggttagcttacaccgccaaaatgctggcgtatcggtggcgaggcgtggtcttcg tggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccg ccaaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgca ggtgcgctggctggcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctatt gggctaacggtcgtcgtcctctggcgctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcc tgaggtgtacaaagcgattaacattgcgcaaaacaccgcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaat caccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgtgaagaactcccgatgaaaccggaagacatcg acatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaaggacaaggctcgcaagtctcgcc atatong attratactta hatt tetaattccctta gastags

Where do axons that travel through the posterior root ganglion terminate in the posterior columns O in the anterior horn O in the anterior columns in the posterior horn

Looking at figure 13 12 which type of mechanoreceptor is found in the dermal papilla Ofree nerve endings O Merkel cell fibers O tactile corpuscles Ruffini endings

According to figure 13 11 open mechanically gated channels allow which type of ion to enter the neuron O potassium O sodium O chloride O calcium

Match the type of information with the fibers that carry it You stub your toe and feel pain 3000 You realize that you need to pee You scratch your head Your pupils dilate 1 somatic sensory division 2 visceral sensory division 3 somatic motor division 4 visceral motor division

37 The image could NOT have been obtained from what type of cells XXXX XX XX X 71 31 28 I SI I IR n AR O Muscle O Egg Kidney Liver 35

An area of skin that is innervated by a single cranial or spinal nerve is called a n O somite O dermatome O neuropathy receptive field

Match the type of stimulus with the its receptor light carbon dioxide levels touch temperature pain 1 mechanoreceptor 2 thermoreceptor 3 chemoreceptor 4 photoreceptor 5 nociceptor