Principles of Inheritance & Variation (Genetics) Questions and Answers

Name Match the Parents with the Children You will meet four sets of parents who are missing their children Using the characteristics listed below you will match the children to their parents First you need to complete the table with which trait is dominant or cessive Characteristic Eye Color Hair Color b Ear Lobe b Mid digit hair Tongue Rolling Blue eyes Blonde hair Attached ear lobes No mid digit hair Can t roll tongue Devon s Phenotype Eye Color b b P Phenotype d Brown eyes Blue eyes Brown Hair Blonde hair Free ear lobes Attached ear lobes Mid digit hair Who are the parents In the tables below each parent has been listed their phenotypes and genotypes Complete a Punnett Square for each of the sets of parents to see what their children could have Couple 1 Devon Deo No mid digit hair Able to roll Can t roll tongue Devon s Genotype Mid Digit Hair d bb hh ee dd tt d Genotype BB or Bb h h bb HH or Hh hh EE or Ee ee DD or Dd dd TT or Tt tt Dominant or Recessive Deo s Phenotype Blue eyes Brown hair Attached ear lobes No mid digit hair Rolls tongue Hair Color H h Tongue Rolling T t t Deo s Genotype bb Hh T e e ee dd TT Ear Lobes e e

What is one weakness in the theory that a nucleic acid was the hereditary molecule in the first protocells There are no nucleic acids with catalytic activity Complete nucleotide monomers have not been shown to form under abiotic conditions They cannot provide a template for their own polymerization They require outside energy for polymerization

ATGACGGATCAGCCTCAATACGAATTGGCGTTTAAGGCGGATGCGCCGTAA 1 Write the sequence of the mRNA for the Mutant 3 strain 2 Write the amino acid sequence of the polypeptide that corresponds to the Mutant 3 strain 3 Calling the following mutant Mutant 4 Write the sequence of the DNA coding strand from a transversion nonsense mutation affecting the seventh 7th codon 4 Write the sequence of the DNA template strand for the Mutant 4 strain 5 Write the sequence of the mRNA for the Mutant 4 strain 6 Write the amino acid sequence of the polypeptide that corresponds to the Mutant 4 strain 7 How many possible open reading frames can you identify in the mRNA sequence or coding DNA sequence of the Mutant 4 strain

In humans free earlobes are dominant to attached ear lobes What would the phenotypes and genotype of the offspring be if a homozygous free eared person mated with a homozygous attached earlobe person Parent s genotype Offspring s Genotype frequencies G Ratio 91 Offsprings Phenotype frequencies attached earlobes I

Indicate whether each of the following descriptions better applies to cDNA C genomic DNA G or both B Your answer would be a five letter string composed of letters C and G only e g CGCGC The starting material is mRNA It can be amplified using polymerase chain reaction It can be used to produce libraries This is used in the diagnosis of Covid19 infections The starting material contains intron and exons O CBGBB CBBCG O BGGBC OCBBGG

In prokaryotes how many molecules of ATP can be generated from the complete oxidation of glucose to CO and H 0 2 38 4 36

Biology I Cells Molecular Biology and Genetics ein that is normally localized to the nucleus The und inserted within the nuclear membrane ted to change except the protein sequence reted

Mutated DNA sequence TACCCAGCTTGCGTGGATC mRNA sequence AUGGGOL GAAC GC ACCUAG Amino acid sequence Met GY Arg Thritis Stop 1 What type of mutation is this 2 What is the result of this mutation Part VI Fifth mutant sequence Mutated DNA sequence TACCCAATTGCGTGGATC AUGEGULAACGCACCUAG mRNA sequence Amino acid sequence Gly Stop 1 What type of mutation is this

Directions Transcribe and translate the following strands of DNA to find the mutat the mutation in each mutated sequence Part I Original Wild Type DNA sequence Original DNA sequence TACCCACTTGCGTGGATC mRNA sequence Amino acid sequence AUGG GUGA ACGCACCUAG Met bly Glutamic acicl Ang thre stop Part II First mutant sequence Mutated DNA sequence TACCCACTTCGTGGATC mRNA sequence AUGGGGUGMAG CAGCCUAG Amino acid sequence Met Gly Stop 1 What type of mutation is this Frameshift Mutational What is the result of this mutation ZAA s changed No Stop cado Part III Second mutant sequence Mutated DNA sequence TACCCACTGGCGTGGATC mRNA sequence AUGEGUGACEGCACCUAG Amino acid sequence Met GIY ASP Arg Thr Stop G deleted What type of mutation is this Print Mutation TG What is the result of this mutation art IV Third mutant sequence Mutated DNA sequence TACCCACTTGCGTGCATC RNA sequence mino acid sequence AUGGGUG AAC GOACGUAG Met GIY Glu Arg Thri Stop

BLEM 7 following sequence shows the wild type mRNA of a

11 In cats the allele for a solid fur color F is dominant over the allele for spotted fur Some cats exhibit an extra toe on each paw This condition is known as polydactyly The allele for polydactyly P is dominant over the allele for a normal number of toes p A cat that is heterozygous for both solid fur color and polydactyly FfPp is crossed with a cat that has spotted fur and a normal number of toes ffpp a Use the multiplication rule and the addition rule to find the probability that the offspring has spotted fur Show your work 2 points b Use the multiplication rule and the addition rule to find the probability that the offspring has polydactyly Show your work 2 points What in the proh

7 Huntington s disease is a dominant condition that affects areas of the brain People generally start experiencing symptoms in their 30s or 40s a Identify one question you could ask to help you clarify the role that DNA plays in passing traits such as Huntington s disease from parents to offspring 1 point b Explain how a parent who has Huntington s disease could have a child who does not have the condition Use parent and offspring genotypes to support your answer 2 points

a Describe one early idea about heredity that was shown to be false by Frederick Griffith s research with pneumococci bacteria 1 point b Griffith studied two strains of bacteria the S strain and the R strain Mice injected with the S strain died while mice injected with the R strain did not become ill When he used heat to kill S cells and then injected the dead cells into the mice the mice did not die However when he mixed the heat treated S cells with living R cells the mice got sick and died What was Griffith s conclusion What was the significance of his findings 2 points c Oswald Avery heat treated S cells and then split them into proteins DNA and RNA He then repeated Griffith s experiment by mixing each part of the heat treated S cells with living R cells He found living S cells in the samples containing destroyed proteins and destroyed RNA but he did not find living S cells in the samples containing destroyed DNA What idea did his findings support 1 point d How did Avery s contributions to the understanding of heredity depend on

Use Scenario II to answer the following questions Scenario II R red eyes and r sepia eyes W normal wings w dumpy wings 1 If the male has sepia eyes and dumpy wings what is his genotype 2 If the female has red eyes and normal wings and is homozygous for both traits what is her genotype 3 What is the predict genotype and phenotype of their offspring Please show your work O

In cats short hair is dominant over long hair A cat with a heterozygous genotype for hair length is crossed with a cat with a homozygous recessive genotype What is the probability that an offspring will have the homozygous dominant genotype O A 0 75 OB 0 25 C 0 50 D 0 00

Which two selections correctly pair a term with an example D 4411 BEANSTORM s TEGREY BERE 2010G BEARI BEART Ste IEE CO BEGELEI POPATS PREP 6980441 2009 PALLADI TOEGERUS Hendr LEERD GEERTEN A Trait no bands 1991 HERRER JODEGER COVERE 100 UNCENTZ 5000 1000092616 200614TETEBE DRAGEE SARCOPOLY SOCCER TOPCALEDne Kabice sec9 THE TE CARBIE SEHEN TORE com B Genotype dominant C Phenotype Bb 200 FAILE

Consider the following DNA sequences for four different species 1 AATCG 2 TAATG 3 ATACC 4 ATAGG Based on the principle of parsimony which species shares a most recent common ancestor with a species having the sequence TTACC 1 Species 2 O2 Species 1 3 Species 4 4 Species 3

UNIT3 GENETICS STEP 1 Determine what kind of problem you are trying to solve STEP 2 Determine letters you will use to specify traits STEP 3 Determine parent s genotypes STEP 4 Make your punnett square and make gametes STEP 5 Complete cross and determine possible offspring STEP 6 Determine genotypic and phenotypic ratios Two Factor Crosses Di hybrid Ex A tall green pea plant TTGG is crossed with a short white pea plant ttgg TT or Tt tall tt short GG or Gg green 88 white tg tg tg TG TtGg TtGg TtGg tg TtGg TG TtGg TtGg TtGg TtGg TG X TtGg TtGg TtGg TtGg TG TtGg TtGg TtGg TtGg 16 Tall Green 0 Tall White 0 Short Green 0 Short White 1 A tall green pea plant TTGg is crossed with a tall green pea plant TtGg

6 If RR Rr right handed and rr left handed Use the Punnett square to cross a handed dad with a heterozygous right handed mom What are the chances of having left handed offspring 7 Define sex linked traits 8 Define incomplete dominance 9 Define codominance 10 If RR red RW pink WW white Use the Punnett square to cross two pink flowers What are the chances of having pink offspring

dward go V VI genotype of Beatrice Queen Victoria Leopold Leopold s daughter If Leopold married a non carrier what are the chances of Leopold having a hemophilic daughter Hemophilic son Queen Victoria Alice Leopold the pedigree tell the Albert Beatrice

11 if 68 black BW speckled WW white Use the punnett square to cross a white and a black chicken What are the chances of having white offspring 12 Define diploid 13 Define haploid 14 Define trisomy

For each question make sur Square AND answer the c 1 Long tails are dominant to short Two dogs with heter estimated amount of the offspring having long tails W

Tim and Stephanie from 2 are pregnam againt This time with a baby girl They are servous that she too may get hemophia Based on what you know about Tim and Stephanie what is the probability that they do have a daughter with the disease Show a Ponnett square to support your answer

9 In a pedigree display you see a symbol shaped like a diamond This symbol means that a the individual has won the lottery and is now wealthy b the individual has undergone a gender change operation c it sometimes just looks like a diamond because the people who drew it were not good at drawing squares d the normal individual s gender is unknown or unreported in the pedigree e this is a trick question because pedigrees never have anything except circles and squares

1 Assume that the R allele in tomatoes causes red coloration and r r have yellow coloration Furthermore red color has 75 penetrance Two heterozygous plants are crossed and the offspring are gown to maturity What proportion of these offspring plants are homozygous Write the answer on the back of the scantron sheet

19 A hypothetical skeletal defect in legs of a certain breed of cats is due to a recessive mutation with only 80 penetrance In the kittens produced in crosses between two heterozygous parents the expected proportion of normal to affected offspring is a 90 10 b 45 55 c 85 15 d 4 1 e none of the above

13 It two poodles are heterozygous for the recessive mutation causing wrinked fur what is the probability that their litter of five baby poodles will include only one with wrinked fur a 1 32 b 405 1024 c 1 1024 d 81 1024 e none of the above 14 In a paternity suit the mother has blood type A and the child has blood type O The innocent male defendent has blood type A His genetics instructor tells him that his defense could possibly be strengthened by knowing the blood types of his parents Which of the following parents would help him prove he was not the father a A and O b AB and AB c A and AB d A and B e none of this information would strengthen his defense 15 In a species of parrots red tail feathers R is dominant to having yellow tail feathers rr and when the tail feathers are yellow dark yellow spots can be seen in those that have the homozygous recessive genotype dd The D individuals do not have these dark yellow spots What proportion of the parrots from a dihybrid cross would you expect to have red tail feathers a 75 b 9 16 56 25 c 4 25 d 1 16 6 25 e none of the above

6 Using what you learned regarding the mathematically combined for dihybrid crosses apply the logic to a trihybrid cross cross of three traits A B and C where one parent is homozygous dominant for all three traits and the other parent is homozygous recessive for all three What proportion of the F generation do you predict are heterozygotes 7 If there are 64 offspring in the F generation how many do you predict have the genotype aabbcc and have the recessive phenotype for all three traits How many individuals out of the 64 do you predict have the A phenotype the b phenotype and the

8 How many individuals out of the 64 do you predict have the A phenotype the b phenotype and the C phenotype

Below 1ozygous parents AABB xa from P to F Meme Note how the P individuals can each only produce one type of gam te thus all F offs are heterozygous for both genes Each F heterozygote can make four different gametes 16 boxes on the right P F F F2 AB ab AaBb A a A AA Aa Example a Aa aa X A B A b a B a b B B Bb b Bb bb b BB Recall the FOIL method from algebra FOIL the A phenotype ratio with the B phenotype the dihybrid phenotype ratio of the A and B genes combined Express these as both a ratio and fractions 3 4 3 4 9 16 5 If there are 320 offspring in F from the cross above AB aB Ab ab AB AABB AaBB AABb AaBb aB AaBB aaBB AaBb aaBb Ab AABb AaBb AAbb Aabb ab AaBb aaBb Aabb aabb b How many do you predict are aabb a how many do you predict are heterozygotes for both traits phonotype and the b phenotype

Read the following passage adapted from Wikipedia The credibility of DNA profiling a technique used by forensic scientists to assist in the identification of individuals has taken a severe beating in recent years In August 2009 scientists in Israel raised serious doubts concerning the use of DNA by law enforcement as the ultimate method of identification In a paper published in the journal Forensic Science International Genetics the Israeli researchers demonstrated that it is possible to manufacture DNA in a laboratory thus falsifying DNA evidence The scientists fabricated saliva and blood samples which originally contained DNA from a person other than the supposed donor of the blood and saliva The researchers also showed that using a DNA database it is possible to take information from a profile and manufacture DNA to match it and that this can be done without access to any actual DNA from the person whose DNA they are duplicating It is unknown how many police departments currently use the test The test that remained a boon to police for many years in the identification of hardcore criminals has lost much of its shine in the aftermath of the 2009 findings What is the main idea of this passage

Teaching Retrieved from https www edutopia org topic culturally responsive teaching Provide a brief summary of the video 2 3 takeaways and any other relevant information that stood out to you based on the video Part 2 Defining Diversity Enid Lee director of Enidlee Consultants Inc a Toronto based consultancy dedicated to anti racist education organization change once said in an interview I have met some teachers who thing that just because they have kids from different races and backgrounds they have a multicultural classroom Bodies of kids are not enough Au 2014 What does diversity look like in a classroom YALL

Methyl groups in DNA DNA sometimes has chemical groups attached called methyl groups that affect gene expression Suppose that during each hour first a fraction m of unmethylated locations on the DNA become methylated and then a fraction u of methylated locations become unmethylated Find a recursion for the fraction f of the DNA molecule that is methylated

The diploid number of chromosomes in a cell of a domestic cat is 38 The table below shows the number of chromosomes in the cell of a domestic cat after the G2 checkpoint after meiosis and after fertilization After G2 Checkpoint A B C D A A 76 B C 38 C B 76 38 After Meiosis 38 19 A table showing the number of chromosomes in the cell of a domestic cat 19 38 After Fertilization 19 38 Which of the following options includes the correct number of chromosomes in a cell after each cellular process G2 checkpoint meiosis and fertilization respectively 38 19

In northern Canada a population of rabbits was predominantly white in color The allele for white color is recessive while the allele for gray color is dominant Over the last several decades the average annual temperature of this area has increased and the long term deposits of ice and snow have become scarce We see the result of this change in the graph below Change in Rabbit Population 1850 2000 100 90 80 70 60 50 40 30 20 10 0 Population white gray 1850 white 2000 gray How can we explain this change in terms of allelic frequency O Gray rabbits were more likely to survive in the changed habitat The gray alleles were passed to offspring O In order to survive rabbits changed from white to gray and they passed the gray allele to offspring O Changes in the environment caused genetic mutations that were passed to offspring

10 points Save Antwer Tyra and Sam have been studying genetic disorders specifically sickle cell anemia in biology class Sickle cell anemia is a genetic disease that is common among people of African descent The sickle cell gene is associated with the hemoglobin gene Hb can affect the shape of the hemoglobin red blood cells that carry oxygen in the body An individual that is homozygous for normal hemoglobin will have the genotype HbAHbA and an individual that is homozygous for sickle cell disease will have the genotype HbSHbS The following punnett square shows the outcome for a cross between a parent that is homozygous for normal hemoglobin and a parent that is homozyous for sickle cell disease Hbs Hbs Parent Cross HbAHbA x Hb Hbs HbA HbA HbA Hbs HbA Hbs HbA Hbs HbA Hbs Use the information above to answer the following questions Key HbA normal hemoglobin Hb sickle shaped hemoglobin

Hbs Hbs Hb HbA x Hb Hbs HbA HbA HbA Hbs HbA Hbs HbA Hbs HbA Hbs Hb sickle shaped hemoglobin Tyra and Sam discussed patterns of heredity in biology like codominance and the law of dominance In sickle cell disease individuals with the dominant allele Hb demonstr resistance to malaria Based on the information provided and what was discussed in class Tyra and Sam offered the following explanations about the traits demonstrated in th cross Tyra s Explanation Tyra says that all of the possible offspring from this cross will be resistant to malaria because they will inherit at least one dominant allele Hb for sickle cell from the parent that is homozygous dominant for the disease Based on the law of dominance if the dominant trait is present it is expressed Which student do you think provides a more accurate explanation and why Sam s Explanation because the allele inherited from the homozygous recessive parent cancels out the a Sam says that none of the possible offspring from this cross will be resistant to mala inherited from the homozygous dominant parent The offspring

In cats some are black some are orange and some are calico fur that is both black and orange All calico cats are always female This trait represents two inheritance patterns List which two and expl how you know

If two people who carry the trait for Huntington s disease Hh have a child what is the chance their child will have the disease What is the chance their child will be genotypically normal Show your work in the space below

3 In pea plants purple flowers P are dominant to white flowers p A plant that is heterozygous is self crossed The following phenotypes were observed Purple flowers 543 White flowers 213 Does this data fit the predicted phenotypic ratios Step 1 state the null hypothesis Step 2 determine your expected values Hint what should the phenotypic ratio be Step 3 complete the Chi square chart Step 4 calculate your degrees of freedom Step 5 interpret results Observed O Expected E O E O E O E E q312 Total

9 Duchenne muscular dystrophy is an example of an X linked recessive disorder that causes progressive muscular weakness If a man who is normal XNY has a child with a woman who is a carrier for the disease XNXC what is the chance that their child will have the disease Show wor

12 Recombination frequencies can be easily calculated by adding the number of offspring that are different from the parents then dividing by the total number of offspring Let s say you are studying fruit flies and you cross a wild type grey female with a vestigial black male The F offspring are as follows 650 wild type grey 595 vestigial black 107 wild type black and 91 vestigial grey What is the recombination frequency between the genes for wing type and body color Show work here

10 Eye color red or white in the fly Drosophila is determined by the X chromosome The dominant version of the allele XR causes red eyes while the recessive allele causes white eyes X Females can have red eyes XRXR XRX or white eyes X X Males only receive one copy of the X chromosome so whatever allele version they receive determines their eye color If a white eyed male is crossed with a red eyed heterozygous female what will the phenotypic ratios of the offspring be Show work here

of genetics and lemperature Genetically male fish have two Z chromosomes ZZ and genetically female fish have one Z chromosome and one W chromosome ZW When fish are raised at 22 C zz fish develop into phenotypic males and ZW fish develop into phenotypic females However when fish are raised at 28 C the Z chromosome is modified denoted as Z Z W individuals develop as phenotypic males that are fertile and can pass on the Z chromosome to their offspring even when the offspring are raised at 22 C A cross between a ZW female and a Z Z male is shown in the Punnett square below Z Z Z Z Z ZZ W Z W ZW a Predict the percent of phenotypic males among the FI offspring of the cross shown in the Punnett square if the offspring are raised at 22 C b At least one Z or Z chromosome is necessary for survival of the fish A researcher crossed two fish and observed a 2 1 ratio of males to females among the offspring Based on the information identify the genotype of the male parent in the cross Describe ONE fitness cost to the female of mating with this particular male c In a population of 200 fish 125 are phenotypic males and 75 are phenotypic females Based on your prediction of males to females from question a perform a chi square test to determine if the population is due to random chance or if there is some outside force acting on the population You may either use the equation provided on the formula chart or create a table like you used in class to calculate your chi square value

A Maine coon cat is brought to an island where only wild tabby cats live After mating with other cats on the island some of the kittens have bushy tails and tufted ears Genetic Flow Part A

SB3 a According to Mendel s law of dominance which statement best describes the result of a cross between parents with genotypes Rr and Rr O Only Rr offspring will have red flowers O Because of the law of dominance all offspring will have red flowers All offspring with at least one R will have red flowers O Only RR offspring will have red flowers

What idea is shared by both Lamarck s and Darwin s theories of evolution 1 Environmental changes can lead to the modification of 2 traits Adaptation is driven by differences in survival and reproductive success 3 Traits acquired during an individual s lifetime can be inherited by their offspring 4 Evolution involves a continuous increase in complexity

9 A second cross is done between two plants of unknown genotypes possessing the same traits as in problem 8 The results of the F generation are in the table below Purple yellow 155 Purple green 146 White yellow 52 White green 49 The results for this appear to be more complicated but you know that the ratios between purple white flowers and yellow green seeds are the key to solving the parental genotypes Use problem 8 to help you if you get stuck Show

10 In guinea pigs a black coat B is dominant to an albino coat b and short hair H is dominant to long hair h A BbHh guinea pig is crossed with a bbHH guinea pig If 30 offspring are produced how many would be expected to be a black with short hair b albino with short hair and c albino with long hair Sho

2 In mice the gene C causes pigment to be produced while the recessive gene c makes it impossible to produce pig ment Individuals without pigment are albino Another gene B located on a different chromosome causes a chemical reaction with the pigment and produces a black coat color The recessive gene b causes an incom plete breakdown of the pigment and a tan or light brown color is pro duced The genes that produce black or tan coat color rely on the gene C which produces pigment but are independent of it Indicate the pheno types of the parents and provide the genotypic and phenotypic ratios of the F generation from the following crosses a CCBB x Ccbb b ccBB x CcBb